SubtiBank SubtiBank
yopD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yopD

unknown
locus
BSU_20930
pI
9.93
mw
15.30 kDa
protein length
131 aa Sequence Blast
gene length
396 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,213,083 2,213,478

    The protein

    Protein family

  • UPF0715 family (with [protein|F0EDEDDC16C51EC3AE0CB89B5466705493C079A6|YoaG] and [protein|92237F79F473C2A27B261480F5E7052FABFBA66C|YwlA], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • BKE20930 ([gene|8701D6DED78E548A7310FE5A45D4B082E7E09345|yopD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCAGCACCTCCGCTTG, downstream forward: _UP4_TCGATATTCCTACGAAATTA
  • BKK20930 ([gene|8701D6DED78E548A7310FE5A45D4B082E7E09345|yopD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCAGCACCTCCGCTTG, downstream forward: _UP4_TCGATATTCCTACGAAATTA