SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


H+-coupled [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|MotA]-[protein|FE56753D061344B0F10A6523F49C5C7356AA40B6|MotB] flagellar stator
29.19 kDa
protein length
270 aa Sequence Blast
gene length
813 bp Sequence Blast
[category|SW 4.1.1|Motility and chemotaxis]
flagellar stator subunit

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for efficient pellicle biofilm formation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,434,433 1,435,245

    Phenotypes of a mutant

  • loss of swimming and swarming motility [Pubmed|24296669]
  • mucoid phenotype due to the [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P activated overexpression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon and resulting overproduction of poly-gamma-glutamate [Pubmed|24296669]
  • not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
  • The protein

    Protein family

  • motA family (with [protein|3D42584D65D80A1C73F057714647E29FF6BBD58A|MotP], according to UniProt)
  • Paralogous protein(s)

  • [protein|3D42584D65D80A1C73F057714647E29FF6BBD58A|MotP]
  • Effectors of protein activity

  • the interaction with [protein|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|MotI] inhibits [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|MotA] activity [Pubmed|22821967]
  • [SW|Localization]

  • anchored to the cell wall, extending through the cell membrane [pubmed|29196522]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|6313226], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials


  • 1A631 ( ''motA''::''erm''), [Pubmed|3015878], available at [ BGSC]
  • 1A923 ( ''motA''::''erm''), [Pubmed|12813063], available at [ BGSC]
  • DS7498 (marker-less in NCIB3610) [Pubmed|24296669]
  • BKE13690 ([gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTTTTCACCAAATCCT, downstream forward: _UP4_TTTGCAGAACAAGGAGAGGC
  • BKK13690 ([gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTTTTCACCAAATCCT, downstream forward: _UP4_TTTGCAGAACAAGGAGAGGC
  • References

  • 26122431,6313226,21821766,22821967,24296669,24771657,28378843,29061663,29196522