SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


gamma-DL-glutamyl hydrolase
45.09 kDa
protein length
413 aa Sequence Blast
gene length
1242 bp Sequence Blast
polyglutamic acid degradation
gamma-DL-glutamyl hydrolase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,696,257 3,697,498

    The protein

    Protein family

  • [SW|Peptidase C40 family] (according to UniProt)
  • [SW|Domains]

  • three [SW|NlpC/P60 domain]s (only the central domain is active) [pubmed|29458655]
  • Structure

  • [PDB|4HPE] (from Clostridium difficile, 39% identity)
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials


  • MGNA-A545 (ywtD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35860 ([gene|86B1182DA7283078B0D393DEB607664059AB910E|pgdS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTATTATCTCCTCCT, downstream forward: _UP4_TAAAAGAAAAAGACTCCAAT
  • BKK35860 ([gene|86B1182DA7283078B0D393DEB607664059AB910E|pgdS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTATTATCTCCTCCT, downstream forward: _UP4_TAAAAGAAAAAGACTCCAAT
  • lacZ fusion

  • available in [SW|Daniel Kearns]'s lab [Pubmed|24296669]
  • References


  • 16689787,29215550
  • Original publications

  • 18957862,12644511,15033535,23335395,29608608,29458655