SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


AAA unfoldase, ATPase subunit of the [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] protease, directs proteins phosphorylated on arginine residues to [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]
89.93 kDa
protein length
810 aa Sequence Blast
gene length
2433 bp Sequence Blast
protein degradation, positive regulator of autolysin ([protein|6A21293823151C6980BF52B31A4B249A8440F2E1|LytC] and [protein|29219315D31BA4ADE41687EFF17FE41D6C23D157|LytD]) synthesis
AAA unfoldase, ATPase subunit of the [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] protease

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    103,572 106,004

    Phenotypes of a mutant

  • inactivation of [gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC] reduces sporulation efficiency to 0.4% that of wild type cells; delayed entry into sporulation, defect in engulfment with reduced SigG activity, and production of small spores [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • ATPase/chaperone
  • Protein family

  • ClpA/ClpB family (with [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE], according to UniProt)
  • Paralogous protein(s)

  • [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE]
  • [SW|Domains]

  • AAA-ATPase [ PFAM]
  • [SW|UVR domain] (aa 417-452) (according to UniProt)
  • Modification

  • phosphorylated on Arg-5 and Arg-254 [Pubmed|22517742]
  • phosphorylated on Arg-70 [Pubmed|31221751]
  • Structure

  • [PDB|2K77] (N-terminal domain)
  • [PDB|3PXG], [PDB|3J3U] (the [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA]-[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] complex) [Pubmed|23595989]
  • [SW|Localization]

  • cytoplasmic polar clusters, excluded from the nucleoid, induced clustering upon heatshock, colocalization with [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [ Pubmed]
  • forms foci coincident with nucleoid edges, usually near cell poles [Pubmed|18689473]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8793870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • regulation

  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • view in new tab

    Biological materials


  • [gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]::tet available from the [ Hamoen] Lab
  • BP98 (''clpC''::''spc''), available in [SW|Fabian Commichau]'s lab [Pubmed|25610436]
  • BKE00860 ([gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCGTTCTGTAAATCTTCCAA, downstream forward: _UP4_TAATATAGAAGACGGAAATG
  • BKK00860 ([gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCGTTCTGTAAATCTTCCAA, downstream forward: _UP4_TAATATAGAAGACGGAAATG
  • GFP fusion

  • C-terminal GFP fusions (single copy, also as CFP and YFP variants) available from the [ Hamoen] Lab
  • Antibody

  • available in [SW|Ulf Gerth]'s and [SW|Jörg Stülke]'s labs
  • labs

  • [SW|Leendert Hamoen], Newcastle University, UK [ homepage]
  • [SW|Kürsad Turgay], Freie Universitt Berlin, Germany [ homepage]
  • References


  • 17302811,23375660,23479438,19609260,19781636,26639779,28748186
  • Original Publications

  • 9987115,8016067,9000055,12923101,10447896,9141693,2113920,16497325,19226326,8793870,10809708,14679237,17560370,11684022,8195092,11722737,11914365,12028382,18689476,19361434,9890793,19767395,9987115,11544224,17981983,14763982,8016066,19361434,18689473,20070525,20923420,20852588,22517742,21622759,21368759,21821766,23595989,18786145,16525504,17380125,16163393,12598648,24263382,25610436,26458230,26735940,27014237,27749819,28760849,29165246,29446505,28333276,31221751,31362989