SubtiBank SubtiBank
clpC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

clpC

AAA unfoldase, ATPase subunit of the [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] protease, directs proteins phosphorylated on arginine residues to [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]
locus
BSU_00860
pI
5.75
mw
89.93 kDa
protein length
810 aa Sequence Blast
gene length
2433 bp Sequence Blast
function
protein degradation, positive regulator of autolysin ([protein|6A21293823151C6980BF52B31A4B249A8440F2E1|LytC] and [protein|29219315D31BA4ADE41687EFF17FE41D6C23D157|LytD]) synthesis
product
AAA unfoldase, ATPase subunit of the [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] protease
essential
no
synonyms
mecB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    103,572 106,004

    Phenotypes of a mutant

  • inactivation of [gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC] reduces sporulation efficiency to 0.4% that of wild type cells; delayed entry into sporulation, defect in engulfment with reduced SigG activity, and production of small spores [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • ATPase/chaperone
  • Protein family

  • ClpA/ClpB family (with [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE], according to UniProt)
  • Paralogous protein(s)

  • [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE]
  • [SW|Domains]

  • AAA-ATPase [http://pfam.sanger.ac.uk/family?acc=PF07724 PFAM]
  • [SW|UVR domain] (aa 417-452) (according to UniProt)
  • Modification

  • phosphorylated on Arg-5 and Arg-254 [Pubmed|22517742]
  • phosphorylated on Arg-70 [Pubmed|31221751]
  • Structure

  • [PDB|2K77] (N-terminal domain)
  • [PDB|3PXG], [PDB|3J3U] (the [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA]-[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] complex) [Pubmed|23595989]
  • [SW|Localization]

  • cytoplasmic polar clusters, excluded from the nucleoid, induced clustering upon heatshock, colocalization with [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [http://www.ncbi.nlm.nih.gov/pubmed/18786145 Pubmed]
  • forms foci coincident with nucleoid edges, usually near cell poles [Pubmed|18689473]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]-[gene|CA0939064E70A97434FA450A69E779FD89880613|mcsA]-[gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]-[gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]
    description
    [Pubmed|8793870]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8793870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|30962353], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • induction during diamide stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|30962353]
  • view in new tab

    Biological materials

    Mutant

  • [gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]::tet available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen] Lab
  • BP98 (''clpC''::''spc''), available in [SW|Fabian Commichau]'s lab [Pubmed|25610436]
  • BKE00860 ([gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCGTTCTGTAAATCTTCCAA, downstream forward: _UP4_TAATATAGAAGACGGAAATG
  • BKK00860 ([gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCGTTCTGTAAATCTTCCAA, downstream forward: _UP4_TAATATAGAAGACGGAAATG
  • GFP fusion

  • C-terminal GFP fusions (single copy, also as CFP and YFP variants) available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen] Lab
  • Antibody

  • available in [SW|Ulf Gerth]'s and [SW|Jörg Stülke]'s labs
  • labs

  • [SW|Leendert Hamoen], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/l.hamoen homepage]
  • [SW|Kürsad Turgay], Freie Universitt Berlin, Germany [http://www.biologie.fu-berlin.de/en/microbio/mibi-turg/index.html homepage]
  • References

    Reviews

  • 17302811,23375660,23479438,19609260,19781636,26639779,28748186
  • Original Publications

  • 9987115,8016067,9000055,12923101,10447896,9141693,2113920,16497325,19226326,8793870,10809708,14679237,17560370,11684022,8195092,11722737,11914365,12028382,18689476,19361434,9890793,19767395,9987115,11544224,17981983,14763982,8016066,19361434,18689473,20070525,20923420,20852588,22517742,21622759,21368759,21821766,23595989,18786145,16525504,17380125,16163393,12598648,24263382,25610436,26458230,26735940,27014237,27749819,28760849,29165246,29446505,28333276,31221751,31362989