SubtiBank SubtiBank
clpC
The papers of the month are back! Check them out! Link here

clpC

AAA unfoldase, ATPase subunit of the [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] protease, directs proteins phosphorylated on arginine residues to [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]
locus
BSU00860
pI
5.75
mw
89.93 kDa
protein length
810 aa Sequence Blast
gene length
2430 bp Sequence Blast
function
protein degradation, positive regulator of autolysin (LytC and LytD) synthesis
product
AAA unfoldase, ATPase subunit of the [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] protease
essential
no
synonyms
mecB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    103,572 → 106,004

    Phenotypes of a mutant

  • inactivation of [gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC] reduces sporulation efficiency to 0.4% that of wild type cells; delayed entry into sporulation, defect in engulfment with reduced SigG activity, and production of small spores [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • ATPase/chaperone
  • Protein family

  • [gene|331993A875907C10C77105FD8DDD86D4412CE405|mecA] family (according to Swiss-Prot) clpA/clpB family. [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] subfamily (according to Swiss-Prot), AAA -type ATPase (IPR013093) [http://www.ebi.ac.uk/interpro/IEntry?ac=IPR013093 InterPro] (PF07724) [http://pfam.sanger.ac.uk/family?acc=PF07724 PFAM]
  • Paralogous protein(s)

  • [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE], [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|ClpX]
  • [SW|Domains]

  • AAA-ATPase [http://pfam.sanger.ac.uk/family?acc=PF07724 PFAM]
  • Modification

  • phosphorylated on Arg-5 and Arg-254 [Pubmed|22517742]
  • Structure

  • [PDB|2K77] (N-terminal domain)
  • [PDB|3PXG], [PDB|3J3U] (the [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA]-[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] complex) [Pubmed|23595989]
  • [SW|Localization]

  • cytoplasmic polar clusters, excluded from the nucleoid, induced clustering upon heatshock, colocalization with [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [http://www.ncbi.nlm.nih.gov/pubmed/18786145 Pubmed]
  • forms foci coincident with nucleoid edges, usually near cell poles [Pubmed|18689473]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]-[gene|CA0939064E70A97434FA450A69E779FD89880613|mcsA]-[gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]-[gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]
    description
    [Pubmed|8793870]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8793870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • regulation

  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • view in new tab

    Biological materials

    Mutant

  • [gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]::tet available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen] Lab
  • BP98 (''clpC''::''spc''), available in [SW|Fabian Commichau]'s lab [Pubmed|25610436]
  • BKE00860 (Δ[gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCGTTCTGTAAATCTTCCAA, downstream forward: _UP4_TAATATAGAAGACGGAAATG
  • BKK00860 (Δ[gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCGTTCTGTAAATCTTCCAA, downstream forward: _UP4_TAATATAGAAGACGGAAATG
  • GFP fusion

  • C-terminal GFP fusions (single copy, also as CFP and YFP variants) available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen] Lab
  • Antibody

  • available in [SW|Ulf Gerth]'s and [SW|Jörg Stülke]'s labs
  • Labs working on this gene/protein

  • [SW|Leendert Hamoen], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/l.hamoen homepage]
  • [SW|Kürsad Turgay], Freie Universität Berlin, Germany [http://www.biologie.fu-berlin.de/en/microbio/mibi-turg/index.html homepage]
  • References

    Reviews

  • 17302811,23375660,23479438,19609260,19781636,26639779,28748186
  • Original Publications

  • 9987115,8016067,9000055,12923101,10447896,9141693,2113920,16497325,19226326,8793870,10809708,14679237,17560370,11684022,8195092,11722737,11914365,12028382,18689476,19361434,9890793,19767395,9987115,11544224,17981983,14763982,8016066,19361434,18689473,20070525,20923420,20852588,22517742,21622759,21368759,21821766,23595989,18786145,16525504,17380125,16163393,12598648,24263382,25610436,26458230,26735940,27014237,27749819,28760849,29165246,29446505