SubtiBank SubtiBank
ohrA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ohrA

peroxiredoxin , protects the cell against organic peroxides
locus
BSU_13140
pI
5.06
mw
14.73 kDa
protein length
141 aa Sequence Blast
gene length
426 bp Sequence Blast
function
organic peroxide resistance
product
peroxiredoxin
essential
no
synonyms
yklA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,380,978 1,381,403

    The protein

    Protein family

  • osmC/ohr family (with [protein|C36DD4B670D803C5700428F62E6CA7ED127E4B41|OhrB] and [protein|0785B4C70C3DD00EFB8BCDD91EF4F98EF4372186|YmaD], according to UniProt)
  • Paralogous protein(s)

  • [protein|C36DD4B670D803C5700428F62E6CA7ED127E4B41|OhrB]
  • Structure

  • [PDB|2BJO] ([protein|C36DD4B670D803C5700428F62E6CA7ED127E4B41|OhrB], 51% identity) [pubmed|18084074]
  • Expression and Regulation

    Operons

    genes
    [gene|869E46AECF6249610F8541E403D834284B62171D|ohrA]
    description
    [Pubmed|9696771]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9696771], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7A3A8AF7728474204396BB7A548F747D28E6FAC7|OhrR]: repression, [Pubmed|11418552], in [regulon|7A3A8AF7728474204396BB7A548F747D28E6FAC7|OhrR regulon]
  • regulation

  • induced by organic peroxides ([protein|search|OhrR]) [Pubmed|11418552]
  • view in new tab

    Biological materials

    Mutant

  • GP1727 [gene|869E46AECF6249610F8541E403D834284B62171D|ohrA]::tet trpC2 available in [SW|Jörg Stülke]'s lab
  • MGNA-A749 (yklA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/749 NBRP B. subtilis, Japan]
  • BKE13140 ([gene|869E46AECF6249610F8541E403D834284B62171D|ohrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCATTCCCCCAATA, downstream forward: _UP4_TAAATAAAAAGAGGATGCCT
  • BKK13140 ([gene|869E46AECF6249610F8541E403D834284B62171D|ohrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCATTCCCCCAATA, downstream forward: _UP4_TAAATAAAAAGAGGATGCCT
  • References

  • 16209951,12486061,11418552,9696771,18084074