SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


peroxiredoxin , protects the cell against organic peroxides
14.73 kDa
protein length
141 aa Sequence Blast
gene length
426 bp Sequence Blast
organic peroxide resistance

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    1,380,978 1,381,403

    The protein

    Protein family

  • osmC/ohr family (with [protein|C36DD4B670D803C5700428F62E6CA7ED127E4B41|OhrB] and [protein|0785B4C70C3DD00EFB8BCDD91EF4F98EF4372186|YmaD], according to UniProt)
  • Paralogous protein(s)

  • [protein|C36DD4B670D803C5700428F62E6CA7ED127E4B41|OhrB]
  • Structure

  • [PDB|2BJO] ([protein|C36DD4B670D803C5700428F62E6CA7ED127E4B41|OhrB], 51% identity) [pubmed|18084074]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9696771], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7A3A8AF7728474204396BB7A548F747D28E6FAC7|OhrR]: repression, [Pubmed|11418552], in [regulon|7A3A8AF7728474204396BB7A548F747D28E6FAC7|OhrR regulon]
  • regulation

  • induced by organic peroxides ([protein|search|OhrR]) [Pubmed|11418552]
  • view in new tab

    Biological materials


  • GP1727 [gene|869E46AECF6249610F8541E403D834284B62171D|ohrA]::tet trpC2 available in [SW|Jörg Stülke]'s lab
  • MGNA-A749 (yklA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13140 ([gene|869E46AECF6249610F8541E403D834284B62171D|ohrA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCATTCCCCCAATA, downstream forward: _UP4_TAAATAAAAAGAGGATGCCT
  • BKK13140 ([gene|869E46AECF6249610F8541E403D834284B62171D|ohrA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCATTCCCCCAATA, downstream forward: _UP4_TAAATAAAAAGAGGATGCCT
  • References

  • 16209951,12486061,11418552,9696771,18084074