SubtiBank SubtiBank
dltC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

dltC

D-alanine carrier protein, alanylation of teichoic acid provides some resistance against positively charged antimicrobial peptides
locus
BSU_38520
pI
3.62
mw
8.87 kDa
protein length
gene length
237 bp Sequence Blast
function
biosynthesis of teichoic acid
product
D-alanine carrier protein
essential
no
ec
6.1.1.13
synonyms
ipa-3r

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.4|Biosynthesis of teichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.3|Biosynthesis of teichoic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    3,954,987 3,955,223

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Protein family

  • DltC family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|Carrier domain] (aa 1-78) (according to UniProt)
  • Modification

  • modified with the 4-phosphopantetheine (Ppant) group at Ser35, by [protein|200BE4802FCE3C860565B374EAADC9C1FEEF3E49|AcpS] [pubmed|30283133], then further modified with a d-alanyl group by [protein|795CD64B65D7CBF26E5F706C7617196CC6FCF864|DltA], through a thioester bond [pubmed|30283133]
  • Structure

  • [PDB|4BPG] [Pubmed|26193422]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|459ED28A98F4EC7E8A9016C742DC8EB5C26B5E65|ywzH]-[gene|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA]-[gene|1B9BAEBE029BE9D4AD7E49C38B1E6DB5E8F4D4D3|dltB]-[gene|862D977CF1E185597329A1EF0915485F72482A03|dltC]-[gene|D178EC8A1FF22C99C437E01FC4843C5176564992|dltD]-[gene|2FB3F09DA60A40212FE20217A64DAE714AB807CF|dltE]
    description
    [Pubmed|29794222]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|7797557], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|14762009], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, [Pubmed|21926231], in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulatory mechanism

  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|7797557], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • expression is reduced in a [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV] mutant [Pubmed|21926231]
  • the mRNA is processed between [gene|459ED28A98F4EC7E8A9016C742DC8EB5C26B5E65|ywzH] and [gene|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE38520 ([gene|862D977CF1E185597329A1EF0915485F72482A03|dltC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAATCCATAGCTTTCTAAT, downstream forward: _UP4_AATCAGCTGTCTGAGTTGAA
  • BKK38520 ([gene|862D977CF1E185597329A1EF0915485F72482A03|dltC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAATCCATAGCTTTCTAAT, downstream forward: _UP4_AATCAGCTGTCTGAGTTGAA
  • References

    Reviews

  • 24819367
  • Original publications

  • 14762009,15955059,26193422,7797557,23980836,21856855,21926231,11434765,30283133