SubtiBank SubtiBank
ytfP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytfP

putative NAD(FAD)-utilizing dehydrogenase
locus
BSU_30060
pI
9.57
mw
35.01 kDa
protein length
420 aa Sequence Blast
gene length
1263 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,075,367 3,076,629

    The protein

    Structure

  • [PDB|2I0Z] (from B. cereus, 70% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|86274AAF9E0D0882F1AD9D4A528BECB013B71C38|ytfP]-[gene|597B517CA4277E33153F80919213BFF7BE495563|opuD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21296969], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|21296969], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by cold stress [Pubmed|21296969]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A816 (ytfP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/816 NBRP B. subtilis, Japan]
  • BKE30060 ([gene|86274AAF9E0D0882F1AD9D4A528BECB013B71C38|ytfP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTATCATCAACTTTC, downstream forward: _UP4_TAATCATTACTCTTTAAATC
  • BKK30060 ([gene|86274AAF9E0D0882F1AD9D4A528BECB013B71C38|ytfP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTATCATCAACTTTC, downstream forward: _UP4_TAATCATTACTCTTTAAATC