SubtiBank SubtiBank
dtd
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dtd

D-aminoacyl-tRNA deacylase
locus
BSU27590
pI
4.35
mw
14.35 kDa
protein length
132 aa Sequence Blast
gene length
399 bp Sequence Blast
function
prevention of misincorporation of D-amino acids into proteins
product
D-aminoacyl-tRNA deacylase
essential
no
synonyms
yrvI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]
  • Gene

    Coordinates
    2,820,077 2,820,475

    Phenotypes of a mutant

  • D-amino acids are toxic [Pubmed|24097941]
  • due to a mutation, the protein is not expressed in standard strains such as 168 and NCIB3610 [Pubmed|24097941]
  • The protein

    Protein family

  • DTD family (according to Swiss-Prot)
  • Structure

  • [PDB|2DBO] (from Aquifex aeolicus, 55% identity)
  • Additional information

  • due to a mutation, the protein is not expressed in standard strains such as 168 and NCIB3610 [Pubmed|24097941]
  • Expression and Regulation

    Operons

    genes
    [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]-[gene|860F8A7D054BF483D43B4659732F5A6D30DACBD9|dtd]
    description
    [Pubmed|9383190]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A825 (yrvI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/825 NBRP B. subtilis, Japan]
  • BKE27590 ([gene|860F8A7D054BF483D43B4659732F5A6D30DACBD9|dtd]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTAACGCTTGCTTCTG, downstream forward: _UP4_TAAAAAAAGCTGCCAAAAGG
  • BKK27590 ([gene|860F8A7D054BF483D43B4659732F5A6D30DACBD9|dtd]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTAACGCTTGCTTCTG, downstream forward: _UP4_TAAAAAAAGCTGCCAAAAGG
  • References

  • 9383190,24097941,14527667,15292242