SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


involved in polyketide synthesis
44.97 kDa
protein length
416 aa Sequence Blast
gene length
1248 bp Sequence Blast
polyketide synthesis

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    1,788,695 → 1,789,942

    The protein

    Catalyzed reaction/ biological activity

  • H+ + malonyl-[ACP] --> acetyl-[ACP] + CO2 (according to UniProt)
  • Protein family

  • [SW|thiolase-like superfamily] (according to UniProt)
  • Structure

  • [PDB|4LS5] ([protein|5D5D9A544295DD9B55C75A8CF47AB19935E740C6|FabF], 30% identity) [pubmed|24641521]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|24187085], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|24187085], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed during the transition from growth to stationary phase ([protein|search|AbrB], [protein|search|CodY]) [Pubmed|24187085]
  • additional information

  • this is a very large operon comprising about 75 kb
  • view in new tab

    view in new tab

    Biological materials


  • BKE17140 (Δ[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACGCCTACACCGGTCACCA, downstream forward: _UP4_GAGAAATGTGGAGGCGAATC
  • BKK17140 (Δ[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACGCCTACACCGGTCACCA, downstream forward: _UP4_GAGAAATGTGGAGGCGAATC
  • References

  • 22383849,24187085,27766092,24641521