SubtiBank SubtiBank
ytpA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytpA

phospholipase (annotated as a bacilysocin synthase)
locus
BSU_30510
pI
6.77
mw
29.42 kDa
protein length
259 aa Sequence Blast
gene length
780 bp Sequence Blast
function
lipid degradation
product
phospholipase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,122,662 3,123,441

    The protein

    Catalyzed reaction/ biological activity

  • cleaves fatty acids from the 2 position of phosphatidylglycerol [Pubmed|11796336]
  • Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • [SW|Domains]

  • 3 [SW|AB hydrolase-1 domain]s (aa 37-52, aa 84-97, aa 198-212) (according to InterPro)
  • Structure

  • [PDB|3HJU] (human monoglyceride lipase, 30% identity) [Pubmed|19957260]
  • Expression and Regulation

    Operons

    genes
    [gene|85A653AF4752A61A39F9C42FC791B2D1444886B1|ytpA]-[gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]
    description
    [Pubmed|18179421]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulation

  • expressed under conditions of salt stress ([protein|search|SigM]) [http://www.ncbi.nlm.nih.gov/sites/entrez/18179421 Pubmed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A128 (ytpA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/128 NBRP B. subtilis, Japan]
  • BKE30510 ([gene|85A653AF4752A61A39F9C42FC791B2D1444886B1|ytpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCACCTCATACG, downstream forward: _UP4_TGAACTAGTAGGGGGTGCAT
  • BKK30510 ([gene|85A653AF4752A61A39F9C42FC791B2D1444886B1|ytpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCACCTCATACG, downstream forward: _UP4_TGAACTAGTAGGGGGTGCAT
  • References

  • 18179421,11796336,19957260