SubtiBank SubtiBank
yuzD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yuzD

unknown
locus
BSU_32210
pI
4.65
mw
12.52 kDa
protein length
108 aa Sequence Blast
gene length
327 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,309,960 3,310,286

    The protein

    Structure

  • [PDB|1XG8] (from Staphylococcus aureus, 46% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|8555CE46AFEB97387872E2E4EC5BEBD4CEA0F0BB|yuzD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B576 (yuzD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1575 NBRP B. subtilis, Japan]
  • BKE32210 ([gene|8555CE46AFEB97387872E2E4EC5BEBD4CEA0F0BB|yuzD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGTAGACGCCCCCTTC, downstream forward: _UP4_TGACTTGATCAGCGGTTCTT
  • BKK32210 ([gene|8555CE46AFEB97387872E2E4EC5BEBD4CEA0F0BB|yuzD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGTAGACGCCCCCTTC, downstream forward: _UP4_TGACTTGATCAGCGGTTCTT