SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


12.52 kDa
protein length
108 aa Sequence Blast
gene length
327 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,309,960 3,310,286

    The protein


  • [PDB|1XG8] (from Staphylococcus aureus, 46% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B576 (yuzD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32210 ([gene|8555CE46AFEB97387872E2E4EC5BEBD4CEA0F0BB|yuzD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGTAGACGCCCCCTTC, downstream forward: _UP4_TGACTTGATCAGCGGTTCTT
  • BKK32210 ([gene|8555CE46AFEB97387872E2E4EC5BEBD4CEA0F0BB|yuzD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGTAGACGCCCCCTTC, downstream forward: _UP4_TGACTTGATCAGCGGTTCTT