SubtiBank SubtiBank
dppE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dppE

dipeptide [SW|ABC transporter] (dipeptide-binding protein)
locus
BSU_12960
pI
5.52
mw
62.41 kDa
protein length
549 aa Sequence Blast
gene length
1650 bp Sequence Blast
function
uptake of dipeptides
product
dipeptide [SW|ABC transporter] (dipeptide-binding protein)
essential
no
synonyms
dciAE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.3|Uptake of peptides]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.4|Utilization of peptides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,364,151 1,365,800

    The protein

    Protein family

  • [SW|bacterial solute-binding protein 5 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|302DFA46D73E18C4663468ED6033C55056744475|OppA]
  • Structure

  • [PDB|4FAJ] (from Enterococcus faecalis, 33% identity) [pubmed|22948145]
  • [SW|Localization]

  • attached to the cell membrane (via [protein|062AE5FB4C778178A7F6833CB8BD9D631E461E89|DppB]-[protein|EDF8D2C49FA5552B24135E12524F9035E1E01473|DppC]) [Pubmed|10092453,18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]
    description
    [Pubmed|1766371]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1766371], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|7783641], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by glucose (2.9-fold) [Pubmed|12850135]
  • view in new tab

    genes
    [gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]-[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]-[gene|77EFC47449D8CC17651ED61C41AC605FCEF01270|ykfB]-[gene|D40ECAE51D9E4791C6FAAA25E2E0D0591D9FAA55|ykfC]-[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • view in new tab

    Biological materials

    Mutant

  • GP1110 (spc), available in [SW|Jörg Stülke]'s lab
  • 1A737 ( ''dppE''::''kan''), [Pubmed|1766370], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A737&Search=1A737 BGSC]
  • BKE12960 ([gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTCCCCCTTTTCA, downstream forward: _UP4_TGATGGAGGCGATTGAGGAA
  • BKK12960 ([gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTCCCCCTTTTCA, downstream forward: _UP4_TGATGGAGGCGATTGAGGAA
  • References

  • 12618455,10092453,1766371,7783641,1766371,18763711,22948145