SubtiBank SubtiBank
rsbX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rsbX

protein serine phosphatase, feedback PP2C, dephosphorylates RsbS and RsbR
locus
BSU_04740
pI
6.23
mw
22.00 kDa
protein length
199 aa Sequence Blast
gene length
600 bp Sequence Blast
function
control of SigB activity
product
protein serine phosphatase, feedback PP2C
essential
no
ec
3.1.3.3
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    523,650 524,249

    The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR]-P [Pubmed|15466036] and [protein|841CE7FCA4E84445830CA18F9856F6F30014E3BB|RsbS]-S59-P [Pubmed|8824586,21362065]
  • H2O + O-phospho-L-(or D)serine --> L-(or D)serine + phosphate (according to UniProt)
  • Structure

  • [PDB|3W42], [PDB|3W43] [Pubmed|26057679]
  • Expression and Regulation

    Operons

    genes
    [gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]-[gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]-[gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]-[gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]-[gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
    description
    [Pubmed|8002610]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002610], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|20454630], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    genes
    [gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
    description
    [Pubmed|2170324]

    regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE04740 ([gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCGTTTTCTTCAACCTGGA, downstream forward: _UP4_TAAAAAACCAGAAAAAGAAG
  • BKK04740 ([gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCGTTTTCTTCAACCTGGA, downstream forward: _UP4_TAAAAAACCAGAAAAAGAAG
  • labs

  • [SW|Bill Haldenwang], San Antonio, USA
  • [SW|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
  • References

  • 8002610,8682769,9658013,8002609,10671474,9068644,19923733,11544224,15466036,8824586,23407164,23320651,21362065,26057679