SubtiBank SubtiBank
yyaN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yyaN

similar to transcriptional regulator ([SW|MerR family])
locus
BSU_40800
pI
9.31
mw
15.91 kDa
protein length
138 aa Sequence Blast
gene length
417 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    4,189,796 4,190,212

    The protein

    Protein family

  • [SW|MerR family]
  • [SW|Domains]

  • [SW|HTH merR-type domain] (aa 3-72) (according to UniProt)
  • Structure

  • [PDB|3QAO] (from Listeria monocytogenes, 29% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|852ECFA6F254167090AA393E6E0D269F49A4CC6E|yyaN]-[gene|D9D907A6004AFE7A4D7BB92A8955593F00DC7A2C|yyaM]-[gene|56A5266F8F42E0FCFDE941CB71AD103120CEB5E9|yyaL]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-B860 (yyaN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1859 NBRP B. subtilis, Japan]
  • BKE40800 ([gene|852ECFA6F254167090AA393E6E0D269F49A4CC6E|yyaN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCCCTCTCATTTAAT, downstream forward: _UP4_TTGAAAGAGGAAGTGGAAAA
  • BKK40800 ([gene|852ECFA6F254167090AA393E6E0D269F49A4CC6E|yyaN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCCCTCTCATTTAAT, downstream forward: _UP4_TTGAAAGAGGAAGTGGAAAA