SubtiBank SubtiBank
ylbB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylbB

putative oxidoreductase
locus
BSU_14950
pI
4.76
mw
16.21 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,565,849 1,566,295

    The protein

    Paralogous protein(s)

  • [protein|AF3ED8916EA02A560EC8D47E4B1C911E871B9AB0|YhcV]:
  • [SW|Domains]

  • 2 [SW|CBS domain]s (aa 8-68, aa 74-130) (according to UniProt)
  • Structure

  • [PDB|4FRY] (protein from ''Burkholderia ambifaria'', 38% identity) [Pubmed|23382856]
  • Expression and Regulation

    Operons

    genes
    [gene|8529D83560E934709B20CCF0B72251A74EC272BB|ylbB]-[gene|2EC813B89149AD39405E66C325FB2684B5987162|ylbC]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B242 (ylbB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1241 NBRP B. subtilis, Japan]
  • BKE14950 ([gene|8529D83560E934709B20CCF0B72251A74EC272BB|ylbB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTTTAACCTCCTTTA, downstream forward: _UP4_TAACACATAAATCTTTGACA
  • BKK14950 ([gene|8529D83560E934709B20CCF0B72251A74EC272BB|ylbB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTTTAACCTCCTTTA, downstream forward: _UP4_TAACACATAAATCTTTGACA
  • Expression vectors

  • pGP2934 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 16497325,15699190,23382856