SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative oxidoreductase
16.21 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,565,849 1,566,295

    The protein

    Paralogous protein(s)

  • [protein|AF3ED8916EA02A560EC8D47E4B1C911E871B9AB0|YhcV]:
  • [SW|Domains]

  • 2 [SW|CBS domain]s (aa 8-68, aa 74-130) (according to UniProt)
  • Structure

  • [PDB|4FRY] (protein from ''Burkholderia ambifaria'', 38% identity) [Pubmed|23382856]
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials


  • MGNA-B242 (ylbB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE14950 ([gene|8529D83560E934709B20CCF0B72251A74EC272BB|ylbB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTTTAACCTCCTTTA, downstream forward: _UP4_TAACACATAAATCTTTGACA
  • BKK14950 ([gene|8529D83560E934709B20CCF0B72251A74EC272BB|ylbB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTTTAACCTCCTTTA, downstream forward: _UP4_TAACACATAAATCTTTGACA
  • Expression vectors

  • pGP2934 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 16497325,15699190,23382856