SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


polyketide synthase
284.73 kDa
protein length
2543 aa Sequence Blast
gene length
7632 bp Sequence Blast
polyketide synthesis
polyketide synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    1,850,890 1,858,521

    The protein


  • 3 [SW|Carrier domain]s (aa 376-452, aa 1407-1485, aa 2134-2208) (according to UniProt)
  • Structure

  • [PDB|4U3V] (enoyl-isomerase domain, aa 1124-1395) [Pubmed|25089587]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|24187085], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|24187085], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed during the transition from growth to stationary phase ([protein|search|AbrB], [protein|search|CodY]) [Pubmed|24187085]
  • additional information

  • this is a very large operon comprising about 75 kb
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-A018 (pksR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17220 ([gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCAGCATTGGCGTTTCCC, downstream forward: _UP4_TGAGAAAACACAAACGCCCC
  • BKK17220 ([gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCAGCATTGGCGTTTCCC, downstream forward: _UP4_TGAGAAAACACAAACGCCCC
  • References

  • 10960106,25089587,17190806,22383849,24187085