SubtiBank SubtiBank
lctP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lctP

lactate permease, excretion
locus
BSU_03060
pI
9.77
mw
57.49 kDa
protein length
541 aa Sequence Blast
gene length
1626 bp Sequence Blast
function
lactate excretion
product
L-lactate permease
essential
no
synonyms
ycgC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.5|Overflow metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    330,771 332,396

    The protein

    Protein family

  • lactate permease family (with [protein|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|LutP], according to UniProt)
  • Paralogous protein(s)

  • [protein|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|LutP]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A0DD68FE90FD13DF03496321AB2DAAADF9F4230D|ldh]-[gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]
    description
    [Pubmed|16207915]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10809684], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, [Pubmed|16207915], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • regulation

  • induced under anaerobic conditions ([protein|search|Rex]) [Pubmed|16207915]
  • view in new tab

    Biological materials

    Mutant

  • BKE03060 ([gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGACAATCAGCCCTTTA, downstream forward: _UP4_TAATAGAAAAAAGCAGTACA
  • BKK03060 ([gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGACAATCAGCCCTTTA, downstream forward: _UP4_TAATAGAAAAAAGCAGTACA
  • GP2578 ([gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab
  • References

  • 16207915,10809684,16428414,17573341