SubtiBank SubtiBank
fhuD [2017-11-16 15:27:27]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fhuD [2017-11-16 15:27:27]

hydroxamate siderophore ABC transporter (only ferrichrome) (binding protein)
34.27 kDa
protein length
315 aa Sequence Blast
gene length
945 bp Sequence Blast
siderophore uptake
hydroxamate siderophore ABC transporter (only ferrichrome) (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,418,474 → 3,419,421

    Phenotypes of a mutant

  • poor growth with the xenosiderophore ferrichrome as single source of iron [Pubmed|23220087]
  • The protein

    Protein family

  • bacterial solute-binding protein 8 family (according to Swiss-Prot)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot), extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,12354229]
  • view in new tab

    Biological materials


  • BKE33320 (Δ[gene|84CC89907EF39770F5BFACA82A11B04CF76EC5AA|fhuD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTCATACCTTCTTTC, downstream forward: _UP4_TAAACAAAAGAGCCGCCTGC
  • BKK33320 (Δ[gene|84CC89907EF39770F5BFACA82A11B04CF76EC5AA|fhuD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTCATACCTTCTTTC, downstream forward: _UP4_TAAACAAAAGAGCCGCCTGC
  • References

  • 10092453,16672620,12354229,18957862,23220087