SubtiBank SubtiBank
fhuD [2017-12-29 10:49:49]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

fhuD [2017-12-29 10:49:49]

hydroxamate siderophore [SW|ABC transporter ](only ferrichrome) (binding protein)
34.27 kDa
protein length
315 aa Sequence Blast
gene length
945 bp Sequence Blast
siderophore uptake
hydroxamate siderophore [SW|ABC transporter ](only ferrichrome) (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,418,474 → 3,419,421

    Phenotypes of a mutant

  • poor growth with the xenosiderophore ferrichrome as single source of iron [Pubmed|23220087]
  • The protein

    Protein family

  • bacterial solute-binding protein 8 family (according to Swiss-Prot)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot), extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,12354229]
  • view in new tab

    Biological materials


  • BKE33320 (Δ[gene|84CC89907EF39770F5BFACA82A11B04CF76EC5AA|fhuD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTCATACCTTCTTTC, downstream forward: _UP4_TAAACAAAAGAGCCGCCTGC
  • BKK33320 (Δ[gene|84CC89907EF39770F5BFACA82A11B04CF76EC5AA|fhuD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTCATACCTTCTTTC, downstream forward: _UP4_TAAACAAAAGAGCCGCCTGC
  • References

  • 10092453,16672620,12354229,18957862,23220087,29133393