SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


protein phosphatase
27.52 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
antagonist of PrkC-dependent phosphorylation
protein phosphatase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • Gene

    1,650,384 1,651,148

    Phenotypes of a mutant

  • A ''prpC'' mutant is less lytic in late stationary phase. [Pubmed|12399479]
  • inactivation of ''[gene|84447F9A6644EA8A7593BB99B2B69D4377E670E2|prpC]'' reduces sporulation efficiency to 50.7% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of [gene|E771685D6D41D48E0C0AF77F15B4F380820FCDC2|EF-tu]]]-Thr63-P [Pubmed|26056311]
  • H2O + O-phospho-L-seryl-[protein] --> L-seryl-[protein] + phosphate (according to UniProt)
  • H2O + O-phospho-L-threonyl-[protein] --> L-threonyl-[protein] + phosphate (according to UniProt)
  • [SW|Domains]

  • [SW|PPM-type phosphatase domain] (aa 2-243) (according to UniProt)
  • [SW|Cofactors]

  • divalent cations such as magnesium or manganese
  • Effectors of protein activity

  • inhibited by inorganic phosphate and glycero-2-phosphate [Pubmed|16857667]
  • Structure

  • [PDB|1TXO] (from ''Mycobacterium tuberculosis'', 34% identity, 54% similarity) [Pubmed|15530359]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B133 (yloO::erm), available at the [ NBRP B. subtilis, Japan]
  • OMG401 (aphA3), available in [SW|Jörg Stülke]'s lab
  • 1A962 (no resistance), [Pubmed|12399479], available at [ BGSC]
  • 1A964 (no resistance), [Pubmed|12399479], available at [ BGSC]
  • BKE15760 ([gene|84447F9A6644EA8A7593BB99B2B69D4377E670E2|prpC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAAGGCTGTTAACAACC, downstream forward: _UP4_CAAGTTGAAGAGGGTGAAGA
  • BKK15760 ([gene|84447F9A6644EA8A7593BB99B2B69D4377E670E2|prpC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAAGGCTGTTAACAACC, downstream forward: _UP4_CAAGTTGAAGAGGGTGAAGA
  • References


  • 21372323
  • Original publications

  • 19246764,10986276,17693724,12399479,18757537,15530359,23793375,16025310,24390483,25012659,26056311,26735940,27806131