SubtiBank SubtiBank
gpsA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

gpsA

glycerol-3-phosphate dehydrogenase (NAD)
locus
BSU_22830
pI
6.23
mw
37.28 kDa
protein length
345 aa Sequence Blast
gene length
1038 bp Sequence Blast
function
biosynthesis of phospholipids
product
glycerol-3-phosphate dehydrogenase (NAD)
essential
no
ec
1.1.1.94
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • Gene

    Coordinates
    2,389,151 2,390,188

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • poor growth [pubmed|28189581]
  • poorly transformable [pubmed|28189581]
  • defective in biofilm formation [pubmed|31420537]
  • The protein

    Catalyzed reaction/ biological activity

  • NAD+ + sn-glycerol 3-phosphate --> dihydroxyacetone phosphate + H+ + NADH (according to UniProt)
  • NADP+ + sn-glycerol 3-phosphate --> dihydroxyacetone phosphate + H+ + NADPH (according to UniProt)
  • Protein family

  • NAD-dependent glycerol-3-phosphate dehydrogenase family (single member, according to UniProt)
  • Structure

  • [PDB|3K96] (from ''Coxiella burnetii RSA 493'', 37% identity, 59% similarity)
  • [SW|Localization]

  • cytoplasm [Pubmed|15743965]
  • Expression and Regulation

    Operons

    genes
    [gene|B2270316642C66BC2DA86EBDCD1BF6A33CC6A1DC|yphC]-[gene|8440C1DBE485BB9EF2904FAA5D709A574C3819A4|gpsA]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|5DA8B27AC6A0E0B4115512BD948C31964D387A8E|yphA]-[gene|448375DF74EB0482A6CD1ACFE04D117C1319E2B2|seaA]-[gene|910109496E4A41EC892996DEEB81971FCBD9CB05|ypzH]-[gene|B2270316642C66BC2DA86EBDCD1BF6A33CC6A1DC|yphC]-[gene|8440C1DBE485BB9EF2904FAA5D709A574C3819A4|gpsA]
    description
    [pubmed|22383849]
    view in new tab

    additional information

  • highly expressed at high iron concentrations [pubmed|31420537]
  • Biological materials

    Mutant

  • BKE22830 ([gene|8440C1DBE485BB9EF2904FAA5D709A574C3819A4|gpsA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGTTTGATTCACACC, downstream forward: _UP4_TAAAAGTGTCAATCAAATGG
  • BKK22830 ([gene|8440C1DBE485BB9EF2904FAA5D709A574C3819A4|gpsA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGTTTGATTCACACC, downstream forward: _UP4_TAAAAGTGTCAATCAAATGG
  • References

  • 7592341,15743965,28189581,31420537