SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


glycerol-3-phosphate dehydrogenase (NAD)
37.28 kDa
protein length
345 aa Sequence Blast
gene length
1038 bp Sequence Blast
biosynthesis of phospholipids
glycerol-3-phosphate dehydrogenase (NAD)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of phospholipids]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • Gene

    2,389,151 2,390,188

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • poor growth [pubmed|28189581]
  • poorly transformable [pubmed|28189581]
  • defective in biofilm formation [pubmed|31420537]
  • The protein

    Catalyzed reaction/ biological activity

  • NAD+ + sn-glycerol 3-phosphate --> dihydroxyacetone phosphate + H+ + NADH (according to UniProt)
  • NADP+ + sn-glycerol 3-phosphate --> dihydroxyacetone phosphate + H+ + NADPH (according to UniProt)
  • Protein family

  • NAD-dependent glycerol-3-phosphate dehydrogenase family (single member, according to UniProt)
  • Structure

  • [PDB|3K96] (from ''Coxiella burnetii RSA 493'', 37% identity, 59% similarity)
  • [SW|Localization]

  • cytoplasm [Pubmed|15743965]
  • Expression and Regulation


    view in new tab

    view in new tab

    additional information

  • highly expressed at high iron concentrations [pubmed|31420537]
  • Biological materials


  • BKE22830 ([gene|8440C1DBE485BB9EF2904FAA5D709A574C3819A4|gpsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGTTTGATTCACACC, downstream forward: _UP4_TAAAAGTGTCAATCAAATGG
  • BKK22830 ([gene|8440C1DBE485BB9EF2904FAA5D709A574C3819A4|gpsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGTTTGATTCACACC, downstream forward: _UP4_TAAAAGTGTCAATCAAATGG
  • References

  • 7592341,15743965,28189581,31420537