SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


glycerol-3-phosphate dehydrogenase (NAD)
37.28 kDa
protein length
345 aa Sequence Blast
gene length
1035 bp Sequence Blast
biosynthesis of phospholipids
glycerol-3-phosphate dehydrogenase (NAD)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of phospholipids]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • Gene

    2,389,151 → 2,390,188

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • poor growth [pubmed|28189581]
  • poorly transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • sn-glycerol 3-phosphate + NAD(P)+ = glycerone phosphate + NAD(P)H (according to Swiss-Prot)
  • Protein family

  • NAD-dependent glycerol-3-phosphate dehydrogenase family (according to Swiss-Prot)
  • Structure

  • [PDB|3K96] (from ''Coxiella burnetii RSA 493'', 37% identity, 59% similarity)
  • [SW|Localization]

  • cytoplasm [Pubmed|15743965]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • BKE22830 (Δ[gene|8440C1DBE485BB9EF2904FAA5D709A574C3819A4|gpsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGTTTGATTCACACC, downstream forward: _UP4_TAAAAGTGTCAATCAAATGG
  • BKK22830 (Δ[gene|8440C1DBE485BB9EF2904FAA5D709A574C3819A4|gpsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGTTTGATTCACACC, downstream forward: _UP4_TAAAAGTGTCAATCAAATGG
  • References

  • 7592341,15743965,28189581