SubtiBank SubtiBank
truA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

truA

pseudouridylate synthase I, universally conserved protein
locus
BSU_01480
pI
6.65
mw
27.90 kDa
protein length
247 aa Sequence Blast
gene length
744 bp Sequence Blast
function
tRNA modification
product
pseudouridylate synthase I
essential
no
ec
5.4.99.12
synonyms
ybaH

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • [category|SW 6|Groups of genes] → [category|SW 6.5|Universally conserved proteins]
  • Gene

    Coordinates
    152,937 153,680

    The protein

    Catalyzed reaction/ biological activity

  • tRNA uridine38-40 --> tRNA pseudouridine38-40 (according to UniProt)
  • Protein family

  • tRNA pseudouridine synthase TruA family (single member, according to UniProt)
  • Structure

  • [PDB|1VS3] (from ''Thermus thermophilus'', 42% identity) [Pubmed|17114947]
  • Additional information

  • [SW|universally conserved protein]
  • Expression and Regulation

    Operons

    genes
    [gene|84334531D66BE7524021C4B40C3FA05AAFE0D7A6|truA]-[gene|B495FFC63413D518138F8C2F3FBC894038C97E0E|rplM]-[gene|C8E45EDBCD0CFF353D1D66E6D77FD81E976BC0BC|rpsI]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [Pubmed|11948165], in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials

    Mutant

  • BKE01480 ([gene|84334531D66BE7524021C4B40C3FA05AAFE0D7A6|truA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCACCTCTAAGCCC, downstream forward: _UP4_TAAACCAGGTGTATAATATT
  • BKK01480 ([gene|84334531D66BE7524021C4B40C3FA05AAFE0D7A6|truA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCACCTCTAAGCCC, downstream forward: _UP4_TAAACCAGGTGTATAATATT
  • References

  • 11948165,17114947