SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


21.16 kDa
protein length
192 aa Sequence Blast
gene length
579 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,183,201 3,183,779

    The protein


  • MOSC domain (aa 15-179) (according to UniProt)
  • Structure

  • [PDB|1ORU]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B542 (yuaD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE31040 ([gene|842CC1FA5050C1832AB82FE149FD8167D5BF294B|yuaD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCTGGCACCTTCCTT, downstream forward: _UP4_AAAGCAGAAAGGGTCTGATT
  • BKK31040 ([gene|842CC1FA5050C1832AB82FE149FD8167D5BF294B|yuaD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCTGGCACCTTCCTT, downstream forward: _UP4_AAAGCAGAAAGGGTCTGATT