SubtiBank SubtiBank
yuaD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yuaD

unknown
locus
BSU_31040
pI
8.06
mw
21.16 kDa
protein length
192 aa Sequence Blast
gene length
579 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,183,201 3,183,779

    The protein

    [SW|Domains]

  • MOSC domain (aa 15-179) (according to UniProt)
  • Structure

  • [PDB|1ORU]
  • Expression and Regulation

    Operons

    genes
    [gene|842CC1FA5050C1832AB82FE149FD8167D5BF294B|yuaD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B542 (yuaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1541 NBRP B. subtilis, Japan]
  • BKE31040 ([gene|842CC1FA5050C1832AB82FE149FD8167D5BF294B|yuaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCTGGCACCTTCCTT, downstream forward: _UP4_AAAGCAGAAAGGGTCTGATT
  • BKK31040 ([gene|842CC1FA5050C1832AB82FE149FD8167D5BF294B|yuaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCTGGCACCTTCCTT, downstream forward: _UP4_AAAGCAGAAAGGGTCTGATT