SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


part of the [SW|stressosome], control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
13.17 kDa
protein length
121 aa Sequence Blast
gene length
366 bp Sequence Blast
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
scaffold protein of the stressosome, anti-[protein|ADC52A22950736A0435AEEEC43F7407878786A81|RsbT]

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    520,237 520,602

    The protein


  • phosphorylation on Ser-59 by [protein|ADC52A22950736A0435AEEEC43F7407878786A81|RsbT] [Pubmed|17218307], dephosphorylation by [protein|8536803BDFB58D43C52961931F609933E49E989D|RsbX] [Pubmed|21362065]
  • Structure

  • [PDB|3VY9] (complete stressosome)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002610], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|20454630], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • BKE04680 ([gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGGATTTTCGGATGTCTCA, downstream forward: _UP4_AAGCGGGAATTGGGGGAATA
  • BKK04680 ([gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGGATTTTCGGATGTCTCA, downstream forward: _UP4_AAGCGGGAATTGGGGGAATA
  • labs

  • [SW|Bill Haldenwang], San Antonio, USA
  • [SW|Chet Price], Davis, USA [ homepage]
  • [SW|Rick Lewis], Newcastle, UK [ homepage]
  • References


  • 19704888,16319496,20658979,28271471
  • Original publications

  • 8002610,8682769,9786195,8682789,10781545,15583165,8824586,10329124,17158665,21821766,16321960,10671474,8808936,15312768,11244072,15342582,16321960,8955331,12950928,15466036,9179850,18832644,17218307,20019076,24599254,23320651,21362065,28727759,28727759