SubtiBank SubtiBank
ctaB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ctaB

heme O synthase (major enzyme)
locus
BSU_14880
pI
9.57
mw
33.79 kDa
protein length
305 aa Sequence Blast
gene length
918 bp Sequence Blast
function
heme biosynthesis
product
heme O synthase (major enzyme)
essential
no
ec
2.5.1.-
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,559,309 1,560,226

    Phenotypes of a mutant

  • inactivation of ''ctaB'' facilitates without a wall (due to reduction of oxidative stress) [Pubmed|26051891]
  • The protein

    Catalyzed reaction/ biological activity

  • (2E,6E)-farnesyl diphosphate + H2O + heme b --> diphosphate + Fe(II)-heme o (according to UniProt)
  • Protein family

  • UbiA prenyltransferase family (with [protein|6CE139563BBD7C1C97AEC3AA3F88146C4EEA79E4|CtaO], according to UniProt)
  • Paralogous protein(s)

  • [protein|6CE139563BBD7C1C97AEC3AA3F88146C4EEA79E4|CtaO]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|83F5D5FCCAFADB7231ACD9BE7941820240954C70|ctaB]-[gene|72D5442C0EF3B404F7B615366E357B68C863CEB6|ctaC]-[gene|20D1174554A03EECE233A1A045F6DF83AF799959|ctaD]-[gene|9DF8423F1D63ED3928B2818F58BC3DECCDBB1DDB|ctaE]-[gene|28E5AF86CE49D7B0ECBFAF9ED5C1FC65D9F810EA|ctaF]-[gene|8C16E115CB59A74C24954BFCDE112720BA09D5EA|ctaG]
    description
    [Pubmed|9829923]

    regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|9829923], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, synergistic repression with [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, synergistic repression with [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|9829923]
  • view in new tab

    Biological materials

    Mutant

  • BKE14880 ([gene|83F5D5FCCAFADB7231ACD9BE7941820240954C70|ctaB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTAAACCTCCCTTA, downstream forward: _UP4_TAAAAAATAGATATGATGCT
  • BKK14880 ([gene|83F5D5FCCAFADB7231ACD9BE7941820240954C70|ctaB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTAAACCTCCCTTA, downstream forward: _UP4_TAAAAAATAGATATGATGCT
  • References

  • 7968515,15491161,9829923,19204012,26051891