SubtiBank SubtiBank
prkA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

prkA

putative serine protein kinase
locus
BSU_08970
pI
5.46
mw
72.71 kDa
protein length
631 aa Sequence Blast
gene length
1896 bp Sequence Blast
function
control of [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]-dependent gene expression
product
putative serine protein kinase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    973,156 975,051

    Phenotypes of a mutant

  • sporulation frequency reduced to 12-27% in knockout [Pubmed|12662922], due to reduced [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK] expression, results from strong repression by [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC] [Pubmed|25983726]
  • The protein

    Catalyzed reaction/ biological activity

  • inactivation of [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC] [Pubmed|25983726]
  • Protein family

  • prkA family (single member, according to UniProt)
  • [SW|Localization]

  • spore coat [Pubmed|25983726]
  • Additional information

  • [http://ecocyc.org/ECOLI/NEW-IMAGE?type=ENZYME&object=G6969-MONOMER the corresponding protein from ''E. coli'' (YeaG)]
  • Expression and Regulation

    Operons

    genes
    [gene|83F1BE86A7AE1098C1319198A8DDA6B8C5F49236|prkA]
    description
    [Pubmed|8626065]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    Biological materials

    Mutant

  • BKE08970 ([gene|83F1BE86A7AE1098C1319198A8DDA6B8C5F49236|prkA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGGACCTCCTCTATCA, downstream forward: _UP4_TAAGCAACGTGACCCGTCCG
  • BKK08970 ([gene|83F1BE86A7AE1098C1319198A8DDA6B8C5F49236|prkA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGGACCTCCTCTATCA, downstream forward: _UP4_TAAGCAACGTGACCCGTCCG
  • References

    Reviews

  • 27148245
  • Original publications

  • 12662922,18276156,12107147,8626065,25983726