SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to transcriptional regulator ([SW|MarR family])
17.13 kDa
protein length
152 aa Sequence Blast
gene length
459 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    608,933 609,391

    The protein

    Protein family

  • [SW|MarR family]
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 3-143) (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials


  • MGNA-C160 (ydgG::erm), available at the [ NBRP B. subtilis, Japan]
  • CS209 (''[gene|833F4B9ECB609D5EBAD0CAA55E1F601A5C1C3787|ydgG]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE05640 ([gene|833F4B9ECB609D5EBAD0CAA55E1F601A5C1C3787|ydgG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATCTTCCCCTCCTCAT, downstream forward: _UP4_TTTAAAGGAGGAGATTCTGC
  • BKK05640 ([gene|833F4B9ECB609D5EBAD0CAA55E1F601A5C1C3787|ydgG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATCTTCCCCTCCTCAT, downstream forward: _UP4_TTTAAAGGAGGAGATTCTGC
  • References

  • 16267290,27197833