SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein, survival of ethanol stress
17.46 kDa
protein length
161 aa Sequence Blast
gene length
486 bp Sequence Blast
survival of ethanol stress

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,427,802 3,428,287

    The protein


  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • MGNA-B060 (yvgO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33410 ([gene|833C00D080B432A29B2D06752F8457225F73862F|yvgO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTTGTTTCCTCCTTTGT, downstream forward: _UP4_TAATATAAAAAAAGCTGGCG
  • BKK33410 ([gene|833C00D080B432A29B2D06752F8457225F73862F|yvgO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTTGTTTCCTCCTTTGT, downstream forward: _UP4_TAATATAAAAAAAGCTGGCG
  • References

  • 18957862,15805528,20817675