SubtiBank SubtiBank
yvgO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvgO

general stress protein, survival of ethanol stress
locus
BSU_33410
pI
4.85
mw
17.46 kDa
protein length
161 aa Sequence Blast
gene length
486 bp Sequence Blast
function
survival of ethanol stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,427,802 3,428,287

    The protein

    [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|833C00D080B432A29B2D06752F8457225F73862F|yvgO]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B060 (yvgO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1059 NBRP B. subtilis, Japan]
  • BKE33410 ([gene|833C00D080B432A29B2D06752F8457225F73862F|yvgO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTTGTTTCCTCCTTTGT, downstream forward: _UP4_TAATATAAAAAAAGCTGGCG
  • BKK33410 ([gene|833C00D080B432A29B2D06752F8457225F73862F|yvgO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTTGTTTCCTCCTTTGT, downstream forward: _UP4_TAATATAAAAAAAGCTGGCG
  • References

  • 18957862,15805528,20817675