SubtiBank SubtiBank
mcpC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mcpC

membrane-bound chemotaxis receptor for proline, methyl-accepting chemotaxis protein
locus
BSU_13950
pI
5.17
mw
71.93 kDa
protein length
655 aa Sequence Blast
gene length
1968 bp Sequence Blast
function
control of chemotaxisthreonine, glycine, serine, lysine, valine and arginine
product
methyl-accepting chemotaxis protein
essential
no
synonyms
prg71

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.4|Membrane-bound chemoreceptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,463,628 1,465,595

    The protein

    Catalyzed reaction/ biological activity

  • deaminated [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|McpC] stimulates phosphorylation of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|CheA] [Pubmed|22931217]
  • [SW|Domains]

  • [SW|Cache domain] (aa 148-225) (according to UniProt)
  • [SW|HAMP domain] (aa 298-350) (according to UniProt)
  • [SW|Methyl-accepting transducer domain] (aa 369-619) (according to UniProt)
  • Modification

  • deamination of Gln-609 (by [protein|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|CheD]) [Pubmed|22931217], deaminated [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|McpC] stimulates phosphorylation of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|CheA] [Pubmed|22931217]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711,21515776]
  • Expression and Regulation

    Operons

    genes
    [gene|8333CD46F704F03A22482CAA98DEFCC945362A10|mcpC]
    description
    [Pubmed|9353924]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9353924], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • additional information

  • in minimal medium, McpC is present with 2,800 /- 640 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials

    Mutant

  • DS180 (''mcpC''::''mls'' in NCIB3610) [Pubmed|12864845]
  • BKE13950 ([gene|8333CD46F704F03A22482CAA98DEFCC945362A10|mcpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCAATCCCCTCCTAAT, downstream forward: _UP4_TAATCCAATTACATCCCCAA
  • BKK13950 ([gene|8333CD46F704F03A22482CAA98DEFCC945362A10|mcpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCAATCCCCTCCTAAT, downstream forward: _UP4_TAATCCAATTACATCCCCAA
  • References

  • 12864845,15317802,8251536,9353924,15544802,6137212,9721285,2505839,2105313,12603740,23038252,18763711,9721285,21515776,22931217,27899502