SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


N-acetylglutamate 5-phosphotransferase
27.57 kDa
protein length
258 aa Sequence Blast
gene length
777 bp Sequence Blast
biosynthesis of arginine
N-acetylglutamate 5-phosphotransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of arginine]
  • Gene

    1,197,326 1,198,102

    The protein

    Catalyzed reaction/ biological activity

  • ATP + N-acetyl-L-glutamate = ADP + N-acetyl-L-glutamate 5-phosphate (according to Swiss-Prot)
  • Protein family

  • acetylglutamate kinase family (according to Swiss-Prot)
  • Structure

  • [PDB|2BTY] (from Thermotoga maritima, 45% identity) [pubmed|16376937]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: repression, [Pubmed|1312212], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24843172], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]) [Pubmed|1312212]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • GP2481 (''[gene|8321DF6EE5B84CC9A4A5DF670E8611F4D61EBC7E|argB]''::''ermC''), available in [SW|Jörg Stülke]'s lab
  • BKE11210 (''[gene|8321DF6EE5B84CC9A4A5DF670E8611F4D61EBC7E|argB]''::''ermC'') (available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE11210 ([gene|8321DF6EE5B84CC9A4A5DF670E8611F4D61EBC7E|argB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCTTCATTTCGCTCCCCT, downstream forward: _UP4_GTCAAAGCAAAGGAGGCTGT
  • BKK11210 ([gene|8321DF6EE5B84CC9A4A5DF670E8611F4D61EBC7E|argB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCTTCATTTCGCTCCCCT, downstream forward: _UP4_GTCAAAGCAAAGGAGGCTGT
  • GP2856 (''[gene|8321DF6EE5B84CC9A4A5DF670E8611F4D61EBC7E|argB]''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • Expression vectors

  • pGP3010: expression of Strep-''argB'' by [SW|pGP380] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • pGP3011: IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844], available in [SW|Jörg Stülke]'s lab
  • pGP3012: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 6096675,24843172,12107147,16376937,1312212,7511775