SubtiBank SubtiBank
yfjP

yfjP

similar to DNA-3-methyladenine glycosidase II
locus
BSU_08010
pI
5.52
mw
33.03 kDa
protein length
287 aa Sequence Blast
gene length
864 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
3.2.2.21
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    872,425 873,288

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of alkylated DNA, releasing 3-methyladenine, 3-methylguanine, 7-methylguanine and 7-methyladenine (according to UniProt)
  • Protein family

  • alkylbase DNA glycosidase AlkA family (with [protein|297DF91EF3E91A6D2DC39BBC7FE8711AB7EBE509|AlkA], according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|82CDC97D16426016CA7E75240C1A6D0D600F4375|yfjP]-[gene|05392BB2C32B0405799D4F34E5BA55FC936AB943|yfjO]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C275 (yfjP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2273 NBRP B. subtilis, Japan]
  • BKE08010 ([gene|82CDC97D16426016CA7E75240C1A6D0D600F4375|yfjP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGATCCACCCTTTTTT, downstream forward: _UP4_TAATTCGTCTGACAATGAAG
  • BKK08010 ([gene|82CDC97D16426016CA7E75240C1A6D0D600F4375|yfjP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGATCCACCCTTTTTT, downstream forward: _UP4_TAATTCGTCTGACAATGAAG
  • References

    Reviews

  • 22933559