SubtiBank SubtiBank
yfjP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yfjP

similar to DNA-3-methyladenine glycosidase II
locus
BSU_08010
pI
5.52
mw
33.03 kDa
protein length
287 aa Sequence Blast
gene length
864 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
3.2.2.21
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    872,425 873,288

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of alkylated DNA, releasing 3-methyladenine, 3-methylguanine, 7-methylguanine and 7-methyladenine (according to UniProt)
  • Protein family

  • alkylbase DNA glycosidase AlkA family (with [protein|297DF91EF3E91A6D2DC39BBC7FE8711AB7EBE509|AlkA], according to UniProt)
  • Structure

  • [PDB|2H56] (from B. halodurans, corresponds to aa 119 ... 285, 29% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|82CDC97D16426016CA7E75240C1A6D0D600F4375|yfjP]-[gene|05392BB2C32B0405799D4F34E5BA55FC936AB943|yfjO]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C275 (yfjP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2273 NBRP B. subtilis, Japan]
  • BKE08010 ([gene|82CDC97D16426016CA7E75240C1A6D0D600F4375|yfjP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGATCCACCCTTTTTT, downstream forward: _UP4_TAATTCGTCTGACAATGAAG
  • BKK08010 ([gene|82CDC97D16426016CA7E75240C1A6D0D600F4375|yfjP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGATCCACCCTTTTTT, downstream forward: _UP4_TAATTCGTCTGACAATGAAG
  • References

    Reviews

  • 22933559