SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to DNA-3-methyladenine glycosidase II
33.03 kDa
protein length
287 aa Sequence Blast
gene length
864 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    872,425 873,288

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of alkylated DNA, releasing 3-methyladenine, 3-methylguanine, 7-methylguanine and 7-methyladenine (according to UniProt)
  • Protein family

  • alkylbase DNA glycosidase AlkA family (with [protein|297DF91EF3E91A6D2DC39BBC7FE8711AB7EBE509|AlkA], according to UniProt)
  • Structure

  • [PDB|2H56] (from B. halodurans, corresponds to aa 119 ... 285, 29% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C275 (yfjP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08010 ([gene|82CDC97D16426016CA7E75240C1A6D0D600F4375|yfjP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGATCCACCCTTTTTT, downstream forward: _UP4_TAATTCGTCTGACAATGAAG
  • BKK08010 ([gene|82CDC97D16426016CA7E75240C1A6D0D600F4375|yfjP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGATCCACCCTTTTTT, downstream forward: _UP4_TAATTCGTCTGACAATGAAG
  • References


  • 22933559