SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


flagellar hook-filament junction proteins, thought to form the hook-filament junction upon which the FliD cap is assembled
32.61 kDa
protein length
298 aa Sequence Blast
gene length
897 bp Sequence Blast
motility and chemotaxis
flagellar hook-filament junction proteins

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • Gene

    3,637,338 3,638,234

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants [Pubmed|24296669]
  • The protein

    Protein family

  • bacterial flagellin family (with [protein|5A94391906ABFE70C5BA14E1E75343BC5805D0D9|YvzB] and [protein|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|Hag], according to UniProt)
  • Structure

  • [PDB|3PWX] (from ''Viubrio parahaemolyticus'', 26% identity)
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412657], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8045879], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8412657], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|21736639], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19898538], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • view in new tab

    view in new tab

    view in new tab

    Biological materials


  • BKE35400 ([gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTGTTACTCTCATGTGAC, downstream forward: _UP4_TAAGCGGCTCTTAGGAGTTC
  • BKK35400 ([gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTGTTACTCTCATGTGAC, downstream forward: _UP4_TAAGCGGCTCTTAGGAGTTC
  • References

  • 8412657,8045879,24296669,21736639