SubtiBank SubtiBank
flgL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

flgL

flagellar hook-filament junction proteins, thought to form the hook-filament junction upon which the FliD cap is assembled
locus
BSU35400
pI
4.42
mw
32.61 kDa
protein length
298 aa Sequence Blast
gene length
897 bp Sequence Blast
function
motility and chemotaxis
product
flagellar hook-filament junction proteins
essential
no
synonyms
yviD

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.2|Flagellar proteins]
  • Gene

    Coordinates
    3,637,338 3,638,234

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants [Pubmed|24296669]
  • The protein

    Protein family

  • bacterial flagellin family (according to Swiss-Prot)
  • Structure

  • [PDB|3PWX] (from ''Viubrio parahaemolyticus'', 26% identity)
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]-[gene|D290247A43280532947B707F3AF388D7A7F404D3|comFB]-[gene|04D9D70C0BCFDCBD00B5156908C348135080A9C2|comFC]-[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]-[gene|E5A59D2AF53FA220BA98D9653589A8F0D24F75B8|yviE]-[gene|6A6CBD75DCC33C804F853F47D37773930D398CFE|fliW]-[gene|93F328524989597C7D2329B25E665496C9631E87|csrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412657], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8045879], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8412657], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|21736639], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19898538], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • view in new tab

    genes
    [gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]
    description
    [Pubmed|21736639]
    view in new tab

    genes
    [gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]
    description
    [Pubmed|8045879]
    view in new tab

    Biological materials

    Mutant

  • BKE35400 ([gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTGTTACTCTCATGTGAC, downstream forward: _UP4_TAAGCGGCTCTTAGGAGTTC
  • BKK35400 ([gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTGTTACTCTCATGTGAC, downstream forward: _UP4_TAAGCGGCTCTTAGGAGTTC
  • References

  • 8412657,8045879,24296669,21736639