SubtiBank SubtiBank
maa
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

maa

maltose O-acetyltransferase
locus
BSU40850
pI
6.16
mw
20.07 kDa
protein length
184 aa Sequence Blast
gene length
555 bp Sequence Blast
function
maltose and maltodextrin utilization
product
maltose O-acetyltransferase
essential
no
ec
2.3.1.79
synonyms
yyaI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.23|Utilization of starch/ maltodextrin]
  • Gene

    Coordinates
    4,195,778 4,196,332

    The protein

    Catalyzed reaction/ biological activity

  • Acetyl-CoA + maltose = CoA + acetyl-maltose (according to Swiss-Prot)
  • Protein family

  • [SW|Transferase hexapeptide repeat family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C6B0EF2CD33D0F5455726167AE8F510619C3F6CA|YvoF]
  • Structure

  • [PDB|2IC7] (from ''Geobacillus kaustophilus'')
  • Biological materials

    Mutant

  • MGNA-B865 (yyaI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1864 NBRP B. subtilis, Japan]
  • BKE40850 ([gene|82869B27A687D1AB2286C2CAB80FBCA29DFD05EF|maa]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCATTTAAGTCACTCCAG, downstream forward: _UP4_TAATGAGATCAGTGCGGCAG
  • BKK40850 ([gene|82869B27A687D1AB2286C2CAB80FBCA29DFD05EF|maa]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCATTTAAGTCACTCCAG, downstream forward: _UP4_TAATGAGATCAGTGCGGCAG
  • References

  • 19087206