SubtiBank SubtiBank
yjlC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjlC

unknown
locus
BSU_12280
pI
4.26
mw
15.44 kDa
protein length
140 aa Sequence Blast
gene length
423 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
rex

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,298,612 1,299,034

    Phenotypes of a mutant

  • poorly transformable [pubmed|28189581]
  • Expression and Regulation

    Operons

    genes
    [gene|8279630BE1D1D214162BA8E06FC05146F9ED517D|yjlC]-[gene|56F407D408272F3674612C9CDFE4A922680EC694|ndh]
    description
    [Pubmed|17015645]

    regulatory mechanism

  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, [Pubmed|17015645], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: repression, [pubmed|28439033], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • induced at high NADH+ levels ([protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]) [Pubmed|17015645]
  • repressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [pubmed|28439033,10913079]
  • view in new tab

    genes
    [gene|2F5683B654BD1B7FA4D55011CCE6413C38DB3F4D|yjlB]-[gene|8279630BE1D1D214162BA8E06FC05146F9ED517D|yjlC]-[gene|56F407D408272F3674612C9CDFE4A922680EC694|ndh]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A359 (yjlC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/359 NBRP B. subtilis, Japan]
  • BKE12280 ([gene|8279630BE1D1D214162BA8E06FC05146F9ED517D|yjlC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCAATTCTCCTTTAC, downstream forward: _UP4_TAATCTCAGATTCAAATTGA
  • BKK12280 ([gene|8279630BE1D1D214162BA8E06FC05146F9ED517D|yjlC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCAATTCTCCTTTAC, downstream forward: _UP4_TAATCTCAGATTCAAATTGA
  • References

  • 17015645,11948165,28439033,10913079,28189581