SubtiBank SubtiBank
cotE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cotE

outer spore coat morphogenetic protein, controls the assembly of the outer spore coat layer
locus
BSU_17030
pI
4.14
mw
20.83 kDa
protein length
181 aa Sequence Blast
gene length
546 bp Sequence Blast
function
assembly of the outer spore coat
product
spore coat morphogenetic protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.2|Class II]
  • Gene

    Coordinates
    1,775,067 1,775,612

    Phenotypes of a mutant

  • mis-assembly of the outer spore coat [Pubmed|22171814]
  • inactivation of ''[gene|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|cotE]'' reduces sporulation efficiency to 49.1% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • assembly of the [protein|9C59B51FC19FC83BD14272008BD441833DD1738E|CotC]-[protein|EB690FA075EAC3E298C47AED082B5FC21E8F8F46|CotU] complex [Pubmed|20023017,18065538]
  • Protein family

  • cotE family (single member, according to UniProt)
  • [SW|Localization]

  • encircles the forespore with a biased accumulation on the mother cell-proximal face of the forespore [Pubmed|23267091,22463703]
  • outer spore coat, localization depends on [protein|A25C1530DA7BB007A288E525404E9F775E219FE8|SpoIVA] [Pubmed|22773792,22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|cotE]
    description
    [Pubmed|8760914]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,1691789], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|1691789], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|1691789,15383836]
  • view in new tab

    Biological materials

    Mutant

  • 1S105 ( ''cotE''::''cat''), [Pubmed|3139490], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S105&Search=1S105 BGSC]
  • BKE17030 ([gene|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|cotE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGGCATGCCTCCTTG, downstream forward: _UP4_TAAAAAAGGGACTAGGGGAG
  • BKK17030 ([gene|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|cotE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGGCATGCCTCCTTG, downstream forward: _UP4_TAAAAAAGGGACTAGGGGAG
  • labs

  • [SW|Arthur Aronson], Purdue University, West Lafayette, USA [http://wwwdev.gradschool.purdue.edu/PULSe/faculty.cfm?fid=5&range=0 homepage]
  • [SW|Adriano Henriques], Lisbon, Portugal [http://www.itqb.unl.pt/research/biology/microbial-development homepage]
  • References

    Reviews

  • 22192522,23202530,27227299
  • Original publications

  • 8748030,17720779,10559171,8760914,15699190,7592342,3139490,8299942,1691789,12644503,17172339,19304857,11737650,12107147,20023017,18065538,22773792,15383836,22171814,23064347,23178679,23267091,22463703,21821751,24086406,25259857,25872412,26484546,26821119,26735940,27320701,28870294,30168214