SubtiBank SubtiBank
csbB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

csbB

lipoteichoic acid glycosyltransferase, general stress protein, required for protection against paraquate stress
locus
BSU_08600
pI
9.20
mw
37.57 kDa
protein length
329 aa Sequence Blast
gene length
990 bp Sequence Blast
function
lipoteichoic acid glycosylation , survival of stress conditions
product
lipoteichoic acid glycosyltransferase
synonyms
yfhN

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.3|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.2|Biosynthesis of lipoteichoic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    930,818 931,807

    The protein

    Protein family

  • [SW|glycosyltransferase 2 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EF18470AD2B07755431534B52A8FCE6754FDBA9D|YkoT], [protein|FD76A781162795EAF174B59C0A90D2ED3ACC0AB7|YkcC]
  • Structure

  • [PDB|5EKP] (from Synechocystis sp., 44% identity) [pubmed|26729507]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|csbB]-[gene|BDFB6CCB5AAD9747971DE6B78E07558706E04617|yfhO]
    description
    [Pubmed|22383849,8921856]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|8921856,9636707], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|8921856,15805528,9636707]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C319 (csbB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2317 NBRP B. subtilis, Japan]
  • BKE08600 ([gene|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|csbB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAGGCACCTTCTTTTT, downstream forward: _UP4_TGAAAATACCAAGCGCCATT
  • BKK08600 ([gene|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|csbB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAGGCACCTTCTTTTT, downstream forward: _UP4_TGAAAATACCAAGCGCCATT
  • References

  • 8921856,9636707,23632331,15805528,22582280,27185829,26729507,29343515