SubtiBank SubtiBank
csbB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

csbB

lipoteichoic acid glycosyltransferase, general stress protein, required for protection against paraquate stress
locus
BSU08600
pI
9.20
mw
37.57 kDa
protein length
329 aa Sequence Blast
gene length
990 bp Sequence Blast
function
lipoteichoic acid glycosylation , survival of stress conditions
product
lipoteichoic acid glycosyltransferase
synonyms
yfhN

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.3|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.2|Biosynthesis of lipoteichoic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    930,818 931,807

    The protein

    Protein family

  • [SW|glycosyltransferase 2 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EF18470AD2B07755431534B52A8FCE6754FDBA9D|YkoT], [protein|FD76A781162795EAF174B59C0A90D2ED3ACC0AB7|YkcC]
  • Structure

  • [PDB|5EKP] (from Synechocystis sp., 44% identity) [pubmed|26729507]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|csbB]-[gene|BDFB6CCB5AAD9747971DE6B78E07558706E04617|yfhO]
    description
    [Pubmed|22383849,8921856]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|8921856,9636707], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|8921856,15805528,9636707]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C319 (csbB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2317 NBRP B. subtilis, Japan]
  • BKE08600 ([gene|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|csbB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAGGCACCTTCTTTTT, downstream forward: _UP4_TGAAAATACCAAGCGCCATT
  • BKK08600 ([gene|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|csbB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAGGCACCTTCTTTTT, downstream forward: _UP4_TGAAAATACCAAGCGCCATT
  • References

  • 8921856,9636707,23632331,15805528,22582280,27185829,26729507,29343515