SubtiBank SubtiBank
yitO
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yitO

unknown
locus
BSU_11055
pI
9.00
mw
35.00 kDa
protein length
309 aa Sequence Blast
gene length
930 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,183,029 1,183,958

    The protein

    Paralogous protein(s)

  • [protein|073D63E17C8248BE39F331FDE9902E21A34056D5|SdpB]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|FBA412B070CE4FFE554F2657E0F745EF5C853B8A|yitP]-[gene|81E929FD7F66A996300C8412BE172883C262BD67|yitO]-[gene|330CB6A25181F7AFD3C63F73CA21A3428882D100|yitM]
    description
    [Pubmed|17850253]

    regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [pubmed|17850253], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • induced in biofilms ([SW|DegU]) [Pubmed|17850253]
  • view in new tab

    Biological materials

    Mutant

  • BKE11055 ([gene|81E929FD7F66A996300C8412BE172883C262BD67|yitO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11055 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCCCATCTGGTGATGGTCT, downstream forward: _UP4_CACAAGAAGGGAGAGGTTTC
  • BKK11055 ([gene|81E929FD7F66A996300C8412BE172883C262BD67|yitO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11055 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCCCATCTGGTGATGGTCT, downstream forward: _UP4_CACAAGAAGGGAGAGGTTTC
  • References

  • 27766092,31622331,17850253