SubtiBank SubtiBank
yitO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yitO

unknown
locus
BSU_11055
pI
9.00
mw
35.00 kDa
protein length
309 aa Sequence Blast
gene length
930 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,183,029 1,183,958

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • BKE11055 ([gene|81E929FD7F66A996300C8412BE172883C262BD67|yitO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11055 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCCCATCTGGTGATGGTCT, downstream forward: _UP4_CACAAGAAGGGAGAGGTTTC
  • BKK11055 ([gene|81E929FD7F66A996300C8412BE172883C262BD67|yitO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11055 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCCCATCTGGTGATGGTCT, downstream forward: _UP4_CACAAGAAGGGAGAGGTTTC
  • References

  • 27766092