SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


14.69 kDa
protein length
128 aa Sequence Blast
gene length
387 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,798,281 3,798,667

    The protein


  • [SW|VOC domain] (aa 5-128) (according to UniProt)
  • Structure

  • [PDB|2P25] (from Enterococcus faecalis, 54% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B654 (ywkD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37020 ([gene|81CCDC33856F2F8BC59BCC7FED34015340D21C48|ywkD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCCCTCCTCGAATTC, downstream forward: _UP4_TAACAGTTTTTGAAGAAAAA
  • BKK37020 ([gene|81CCDC33856F2F8BC59BCC7FED34015340D21C48|ywkD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCCCTCCTCGAATTC, downstream forward: _UP4_TAACAGTTTTTGAAGAAAAA