SubtiBank SubtiBank
sasB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sasB

(p)ppGpp synthetase
locus
BSU_11600
pI
6.71
mw
24.56 kDa
protein length
211 aa Sequence Blast
gene length
636 bp Sequence Blast
function
ppGpp synthesis independent from stringent response
product
(p)ppGpp synthetase
essential
no
synonyms
yjbM,relQ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • Gene

    Coordinates
    1,237,006 1,237,641

    Phenotypes of a mutant

  • a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant requires branched chain amino acids, methionine and threonine for growth, the requirement can be suppressed by reduced expression of ''[gene|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|guaB]'' or inactivation of ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]'' [Pubmed|24163341]
  • a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant acquires suppressor mutations in ''[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA], [gene|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|guaB], [gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]'' or inactivation of ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]'' [Pubmed|24682323,24163341]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + GTP --> AMP + guanosine 3'-diphosphate 5'-triphosphate (according to UniProt)
  • Protein family

  • RelA/SpoT family (with [protein|1107A963C253FBEE8716507BD0EC0E7CD5642B12|SasA] and [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA], according to UniProt)
  • Paralogous protein(s)

  • [protein|1107A963C253FBEE8716507BD0EC0E7CD5642B12|SasA]
  • [SW|Domains]

  • single ppGpp synthetase domain [Pubmed|24163341]
  • Effectors of protein activity

  • allosterically activated by pppGpp [Pubmed|26460002]
  • Structure

  • [PDB|5DEC] [Pubmed|26460002]
  • Expression and Regulation

    Operons

    genes
    [gene|E5A57660B69F9E9BC52FD9C8A5E3C8786CE96728|yjbL]-[gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]-[gene|2A2640A0501ECEA44A3C0C4842FAC053FB422A1F|nadF]-[gene|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|yjbO]
    description
    [Pubmed|18067544]

    regulation

  • expressed during exponential growth
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B159 (yjbM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1158 NBRP B. subtilis, Japan]
  • GP2066 (''[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]::mls''), available in [SW|Jörg Stülke]'s lab
  • BKE11600 ([gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATACATCCCCCAATTC, downstream forward: _UP4_CAATAGGTAAAGGGGAAGAA
  • BKK11600 ([gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATACATCCCCCAATTC, downstream forward: _UP4_CAATAGGTAAAGGGGAAGAA
  • References

    Reviews

  • 27149325,30980074
  • Original publications

  • 22950019,18670626,19447912,18067544,24163341,24489751,24682323,26460002,27875634