SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


flagellar hook cap, required for hook assembly
15.50 kDa
protein length
140 aa Sequence Blast
gene length
423 bp Sequence Blast
flagellar hook assembly
flagellar hook cap

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • Gene

    1,699,738 1,700,160

    Phenotypes of a mutant

  • lack of [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]-dependent gene expression (no ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' expression), no motility [Pubmed|22730131]
  • inactivation of ''[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]'' confers resistance to high concentrations of Zn(II) [Pubmed|27935957]
  • The protein

    Catalyzed reaction/ biological activity

  • flagellar hook assembly [Pubmed|22730131]
  • assists incorporation of a [protein|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|FlgE] monomer into the nascent hook structure [Pubmed|26490009]
  • Protein family

  • FlgD family (single member, according to UniProt)
  • [SW|Localization]

  • flagellum hook (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|20233303], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: regulation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • regulation

  • see [SW|fla-che operon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • MGNA-B104 (ylxG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE16280 ([gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTCATTCTTCTTCCTCCAT, downstream forward: _UP4_TAAAAACATCTGGGGGAATA
  • BKK16280 ([gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTCATTCTTCTTCCTCCAT, downstream forward: _UP4_TAAAAACATCTGGGGGAATA
  • References


  • 26490009
  • Original publications

  • 14651647,9657996,8157612,15175317,17850253,22730131,24386445,27935957