SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


proton-dependent di- and tripeptide transporter
53.11 kDa
protein length
492 aa Sequence Blast
gene length
1479 bp Sequence Blast
uptake of di- and tripeptides
peptide transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Peptide transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of peptides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    416,235 417,713

    The protein

    Protein family

  • PTR2/POT transporter (TC 2.A.17) family (single member, according to UniProt)
  • Structure

  • [PDB|4IKV], the protein from ''Geobacillus kaustophilus'' (65% identity, 87% similarity), [Pubmed|23798427]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|25966844], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|25966844,11717292], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • repressed during exponential growth ([protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]) [Pubmed|25966844,11717292]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • BKE03670 ([gene|819D6C5489F1F3FF63B69162EFB6581A1366F45E|dtpT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCCAAACCCTTTC, downstream forward: _UP4_TAATCAGAAACAGCCCGCGG
  • BKK03670 ([gene|819D6C5489F1F3FF63B69162EFB6581A1366F45E|dtpT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCCAAACCCTTTC, downstream forward: _UP4_TAATCAGAAACAGCCCGCGG
  • References

  • 11717292,8458848,23798427,25966844,25755103,26883633