SubtiBank SubtiBank
ywaA [2019-06-18 09:34:19]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ywaA [2019-06-18 09:34:19]

branched-chain amino acid aminotransferase
40.16 kDa
protein length
363 aa Sequence Blast
gene length
1092 bp Sequence Blast
biosynthesis of branched-chain amino acids
branched-chain amino acid aminotransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of branched-chain amino acids]
  • Gene

    3,957,391 3,958,482

    The protein

    Catalyzed reaction/ biological activity

  • L-leucine + 2-oxoglutarate = 4-methyl-2-oxopentanoate + L-glutamate (according to Swiss-Prot)
  • Protein family

  • [SW|Class-IV pyridoxal-phosphate-dependent aminotransferase family] (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|2A20EF701B9F78FC21A33D6BD8ED862323BA59A8|YbgE]
  • Modification

  • S-cysteinylation after diamide stress (C104) [Pubmed|17611193]
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|3HT5] (from '' Mycobacterium tuberculosis'', 42% identity, 58% similarity) [Pubmed|19923721]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24163341], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|24163341]
  • view in new tab

    Biological materials


  • MGNA-B757 (ywaA::erm), available at the [ NBRP B. subtilis, Japan]
  • a ''ywaA::spc'' mutant and a ''[gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd] [gene|2A20EF701B9F78FC21A33D6BD8ED862323BA59A8|ybgE] [gene|8163996FCB9D02F771E7A04A91D5720027260F12|ywaA]'' triple mutant are available in [SW|Linc Sonenshein]'s lab
  • BKE38550 ([gene|8163996FCB9D02F771E7A04A91D5720027260F12|ywaA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTCAATCTCCCTGCTG, downstream forward: _UP4_TAAGAAAAAAGCCGGCCCAT
  • BKK38550 ([gene|8163996FCB9D02F771E7A04A91D5720027260F12|ywaA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTCAATCTCCCTGCTG, downstream forward: _UP4_TAAGAAAAAAGCCGGCCCAT
  • References

  • 12670965,17611193,24163341,15378759,28516784