SubtiBank SubtiBank
yfiZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfiZ

[SW|ABC transporter] for the siderophore schizokinen and arthrobactin (permease), works with ATPase [protein|5C52DB31F378E49AABE5D937DD901A68F3810477|YusV]
locus
BSU_08450
pI
9.62
mw
34.98 kDa
protein length
333 aa Sequence Blast
gene length
1002 bp Sequence Blast
function
[SW|acquisition of iron]
product
[SW|ABC transporter] for the siderophore schizokinen and arthrobactin (permease)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.5|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.1|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.4|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    920,474 921,475

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|FecCD subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|BDAA56484E05DA3C1CB0CA09873A365657999679|FecD], [protein|3E1C925C31C00803982C8EB1C6B025C22DB4A828|FhuB]
  • Structure

  • [PDB|2NQ2] (complex with [protein|5C52DB31F378E49AABE5D937DD901A68F3810477|YusV]-like protein, from Haemophilus influenzae, 33% identity) [pubmed|17158291]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|81494D4E7E52531802C3C0D0073739DA9375F5DF|yfiZ]-[gene|34A7E22B4EF118EF5A76F8CC2DABBB023BC9A2E9|yfhA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C312 (yfiZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2310 NBRP B. subtilis, Japan]
  • BKE08450 ([gene|81494D4E7E52531802C3C0D0073739DA9375F5DF|yfiZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTAATTCTCCTAGT, downstream forward: _UP4_CTATGAAACTTCGTTTTGGC
  • BKK08450 ([gene|81494D4E7E52531802C3C0D0073739DA9375F5DF|yfiZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTAATTCTCCTAGT, downstream forward: _UP4_CTATGAAACTTCGTTTTGGC
  • References

  • 10092453,16672620,12354229,17158291