SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to dioxin reductive etherase
14.43 kDa
protein length
124 aa Sequence Blast
gene length
375 bp Sequence Blast
dioxin reductive etherase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    2,427,405 2,427,779

    The protein


  • [SW|N-acetyltransferase domain] (aa 3-124) (according to UniProt)
  • Structure

  • [PDB|5XXS] [pubmed|29241954]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8159171], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|FMN-box|FMN-box]: transcription termination, via [SW|FMN-box] in the presence of FMN or FMNH2, this is counter-acted upon binding of [protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|RibR], in [regulon|FMN-box|FMN-box]
  • regulation

  • expressed in the absence of FMN ([SW|FMN-box]) [Pubmed|15808508]
  • the [SW|FMN-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • BKE23240 ([gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACCCCTCTATATC, downstream forward: _UP4_TAAGCAGAGGCTGTGATCAG
  • BKK23240 ([gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACCCCTCTATATC, downstream forward: _UP4_TAAGCAGAGGCTGTGATCAG
  • References

  • 12456892,15808508,23270261,8159171,7934830,24442413,25349719,26494285,29241954,29805114