SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


alkyl monooxygenase, required for the conversion of S-methyl-cysteine to cysteine
49.25 kDa
protein length
442 aa Sequence Blast
gene length
1329 bp Sequence Blast
utilization of S-methyl-cysteine
alkyl monooxygenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|Conversion of S-methyl cysteine to cysteine]
  • Gene

    3,001,724 3,003,052

    Phenotypes of a mutant

  • no growth with S-methyl cysteine [Pubmed|23944997]
  • The protein

    Catalyzed reaction/ biological activity

  • oxidation of S-methyl-cysteine [Pubmed|23944997]
  • Protein family

  • ntaA/snaA/soxA(dszA) monooxygenase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|19E6EF9CCA31440EAC046F8D6CA98B6A08589D58|YxeK]
  • [SW|Cofactors]

  • FMN
  • Structure

  • [PDB|1YW1] (complex with FMN), [PDB|1TVL], [PDB|6ASK], [PDB|6ASL]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    Biological materials


  • MGNA-A155 (ytnJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29310 ([gene|8145952307BC47805A7A9BD39418474358043BFE|cmoJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAACTGAATAAAATCTGCAC, downstream forward: _UP4_TAGGTTTCGTCTGATCGAAT
  • BKK29310 ([gene|8145952307BC47805A7A9BD39418474358043BFE|cmoJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAACTGAATAAAATCTGCAC, downstream forward: _UP4_TAGGTTTCGTCTGATCGAAT
  • References

  • 16109943,15668000,15272571,23944997