SubtiBank SubtiBank
sdhC [2019-02-04 16:06:53]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sdhC [2019-02-04 16:06:53]

succinate dehydrogenase (cytochrome b558 subunit)
22.79 kDa
protein length
202 aa Sequence Blast
gene length
609 bp Sequence Blast
TCA cycle
succinate dehydrogenase (cytochrome b558 subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,908,129 2,908,737

    Phenotypes of a mutant

  • defective in the the ability to support the growth of ''Synechococcus leopoliensis'' CCAP1405/1 on agar media [Pubmed|25875741]
  • The protein

    Protein family

  • cytochrome b558 family (according to Swiss-Prot)
  • [SW|Cofactors]

  • Fe
  • Effectors of protein activity

  • Inhibited by 2-(n-Heptyl)-4-hydroxy-quinoline N-oxide [Pubmed|3910107]
  • Activated by Cytochrome b558 [Pubmed|6799760]
  • Structure

  • [PDB|1NEK] (''E. coli'') [pubmed|12560550]
  • [SW|Localization]

  • membrane protein [Pubmed|18763711]
  • Additional information

  • This enzyme is a trimer membrane-bound [Pubmed|3910107] [Pubmed|6799760]
  • One subunit is bound to citochrome b558, and this subunit is the one bound to the cytosolic side of the membrane [Pubmed|3910107] [Pubmed|6799760]
  • Another subunit is the flavoprotein one, required for FAD usage [Pubmed|3910107] [Pubmed|6799760]
  • The other subunit has an iron-sulphur domain necessary for the catalytic activity [Pubmed|3910107] [Pubmed|6799760]
  • extensive information on the structure and enzymatic properties of succinate dehydrogenase can be found at [ Proteopedia]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2495271], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation inhibition, [Pubmed|22389480]
  • Biological materials


  • MGNA-B028 (sdhC::erm), available at the [ NBRP B. subtilis, Japan]
  • GP743 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]''), cat, available in [SW|Jörg Stülke]'s lab
  • GP792 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]'')::''phleo'', available in [SW|Jörg Stülke]'s lab
  • GP2342 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]'')::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • GP2343 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]'')::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE28450 ∆([gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC])::erm trpC2 available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTACCCCCTGTTT, downstream forward: _UP4_TAAGAGTACTAGATTACTAG
  • BKK28450 ∆([gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC])::kan trpC2 available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTACCCCCTGTTT, downstream forward: _UP4_TAAGAGTACTAGATTACTAG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References


  • 11803018
  • Original publications

  • 6401289,1707123,2120540,7669765,18697947,1324713,3036777,2495271,2176107,3117551,10913269,18763711,12560550,18697947,3910107,6799760,21641999,22389480,23880299,25875741,12560550