SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


succinate dehydrogenase (cytochrome b558 subunit)
22.79 kDa
protein length
202 aa Sequence Blast
gene length
609 bp Sequence Blast
TCA cycle
succinate dehydrogenase (cytochrome b558 subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,908,129 2,908,737

    Phenotypes of a mutant

  • defective in the the ability to support the growth of ''Synechococcus leopoliensis'' CCAP1405/1 on agar media [Pubmed|25875741]
  • defective in biofilm formation [pubmed|31420537]
  • The protein

    Protein family

  • cytochrome b558 family (single member, according to UniProt)
  • [SW|Cofactors]

  • Fe
  • Effectors of protein activity

  • Inhibited by 2-(n-Heptyl)-4-hydroxy-quinoline N-oxide [Pubmed|3910107]
  • Activated by Cytochrome b558 [Pubmed|6799760]
  • Structure

  • [PDB|1NEK] (''E. coli'') [pubmed|12560550]
  • [SW|Localization]

  • membrane protein [Pubmed|18763711]
  • Additional information

  • This enzyme is a trimer membrane-bound [Pubmed|3910107] [Pubmed|6799760]
  • One subunit is bound to citochrome b558, and this subunit is the one bound to the cytosolic side of the membrane [Pubmed|3910107] [Pubmed|6799760]
  • Another subunit is the flavoprotein one, required for FAD usage [Pubmed|3910107] [Pubmed|6799760]
  • The other subunit has an iron-sulphur domain necessary for the catalytic activity [Pubmed|3910107] [Pubmed|6799760]
  • extensive information on the structure and enzymatic properties of succinate dehydrogenase can be found at [ Proteopedia]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2495271], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation inhibition, [Pubmed|22389480]
  • additional information

  • highly expressed at high iron concentrations [pubmed|31420537]
  • Biological materials


  • MGNA-B028 (sdhC::erm), available at the [ NBRP B. subtilis, Japan]
  • GP743 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]'')::cat, available in [SW|Jörg Stülke]'s lab
  • GP792 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]'')::''phleo'', available in [SW|Jörg Stülke]'s lab
  • GP2342 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]'')::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • GP2343 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]'')::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE28450 (∆[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTACCCCCTGTTT, downstream forward: _UP4_TAAGAGTACTAGATTACTAG
  • BKK28450 (∆[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTACCCCCTGTTT, downstream forward: _UP4_TAAGAGTACTAGATTACTAG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References


  • 11803018
  • Original publications

  • 6401289,1707123,2120540,7669765,18697947,1324713,3036777,2495271,2176107,3117551,10913269,18763711,12560550,18697947,3910107,6799760,21641999,22389480,23880299,25875741,12560550,31420537