SubtiBank SubtiBank
bshB2
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bshB2

N-acetylglucosamine-malate deacetylase, minor enzyme involved in bacillithiol synthesis, may act as amidase for the processing of BSH conjugates
locus
BSU_19460
pI
4.51
mw
16.54 kDa
protein length
221 aa Sequence Blast
gene length
666 bp Sequence Blast
function
biosynthesis of bacillithiol
product
N-acetylglucosamin-malate deacetylase
essential
no
synonyms
yojG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.2|Biosynthesis of bacillithiol]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,121,641 2,122,306

    The protein

    Catalyzed reaction/ biological activity

  • (S)-malyl N-acetyl-α-D-glucosaminide + H2O --> (S)-malyl α-D-glucosaminide + acetate (according to UniProt)
  • Protein family

  • PIGL family (with [protein|60367F0396612C8A6491FD92A73B30BED7215506|BshB1], according to UniProt)
  • Paralogous protein(s)

  • [protein|60367F0396612C8A6491FD92A73B30BED7215506|BshB1]
  • Expression and Regulation

    Operons

    genes
    [gene|7922A49FBC7CCDC8C585EF6E67D7CC9CC91059F7|yoyC]-[gene|63EC848DB7CC4464B070E65D2C9288851B08BBE3|yojF]-[gene|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|bshB2]
    description
    (major transcript) [Pubmed|23894131,20308541]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • ''[protein|search|yoyC]'': induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    genes
    [gene|FBF1A8C92149A216D8A46F9E02898D7C5C448E2A|yojE]-[gene|7922A49FBC7CCDC8C585EF6E67D7CC9CC91059F7|yoyC]-[gene|63EC848DB7CC4464B070E65D2C9288851B08BBE3|yojF]-[gene|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|bshB2]
    description
    [Pubmed|23894131]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • ''[protein|search|yoyC]'': induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B428 (yojG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1427 NBRP B. subtilis, Japan]
  • ''bshB2'' null mutant and ''[gene|60367F0396612C8A6491FD92A73B30BED7215506|bshB1]'' / ''[gene|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|bshB2]'' double null mutant available in [SW|John Helmann] lab
  • CS212 (''[gene|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|bshB2]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE19460 ([gene|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|bshB2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATTATTATTCACCCTT, downstream forward: _UP4_TAATCAAAAAGGTATAAGGC
  • BKK19460 ([gene|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|bshB2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATTATTATTCACCCTT, downstream forward: _UP4_TAATCAAAAAGGTATAAGGC
  • References

    Reviews

  • 28117687
  • Original Publications

  • 20308541,19578333,23894131,23758290,27197833