SubtiBank SubtiBank
rpe
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rpe

ribulose 5-phosphate 3-epimerase
locus
BSU_15790
pI
5.65
mw
23.19 kDa
protein length
217 aa Sequence Blast
gene length
654 bp Sequence Blast
function
pentose phosphate pathway
product
ribulose 5-phosphate 3-epimerase
essential
no
ec
5.1.3.1
synonyms
yloR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.3|Pentose phosphate pathway]
  • Gene

    Coordinates
    1,654,004 1,654,657

    The protein

    Catalyzed reaction/ biological activity

  • D-ribulose 5-phosphate --> D-xylulose 5-phosphate (according to UniProt)
  • Protein family

  • ribulose-phosphate 3-epimerase family (single member, according to UniProt)
  • Structure

  • [PDB|1TQJ] (from ''Synechocystis sp.'', 61% identity, 75% similarity) [Pubmed|15333955]
  • Expression and Regulation

    Operons

    genes
    [gene|84447F9A6644EA8A7593BB99B2B69D4377E670E2|prpC]-[gene|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC]-[gene|519D4694B2895EE6F0D38D918F52F27734506848|cpgA]-[gene|8103B8539338B77CF51B16B7FA76783ED2319F13|rpe]-[gene|0ACE023DCD6A6BB5A1827D1D997BDFAC3B168C51|yloS]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B374 (yloR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1373 NBRP B. subtilis, Japan]
  • BKE15790 ([gene|8103B8539338B77CF51B16B7FA76783ED2319F13|rpe]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGATGGTGCAACCTTTATCA, downstream forward: _UP4_TAAGCAGCTTTAGAAAAGAG
  • BKK15790 ([gene|8103B8539338B77CF51B16B7FA76783ED2319F13|rpe]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGATGGTGCAACCTTTATCA, downstream forward: _UP4_TAAGCAGCTTTAGAAAAGAG
  • FLAG-tag construct

  • GP1405 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

  • 15333955