SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


ribulose 5-phosphate 3-epimerase
23.19 kDa
protein length
217 aa Sequence Blast
gene length
654 bp Sequence Blast
pentose phosphate pathway
ribulose 5-phosphate 3-epimerase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Pentose phosphate pathway]
  • Gene

    1,654,004 1,654,657

    The protein

    Catalyzed reaction/ biological activity

  • D-ribulose 5-phosphate --> D-xylulose 5-phosphate (according to UniProt)
  • Protein family

  • ribulose-phosphate 3-epimerase family (single member, according to UniProt)
  • Structure

  • [PDB|1TQJ] (from ''Synechocystis sp.'', 61% identity, 75% similarity) [Pubmed|15333955]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B374 (yloR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15790 ([gene|8103B8539338B77CF51B16B7FA76783ED2319F13|rpe]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGATGGTGCAACCTTTATCA, downstream forward: _UP4_TAAGCAGCTTTAGAAAAGAG
  • BKK15790 ([gene|8103B8539338B77CF51B16B7FA76783ED2319F13|rpe]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGATGGTGCAACCTTTATCA, downstream forward: _UP4_TAAGCAGCTTTAGAAAAGAG
  • FLAG-tag construct

  • GP1405 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

  • 15333955