SubtiBank SubtiBank
recO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

recO

mediator of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] binding to ssDNA, required for the formation of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair centers, required for efficient survival and replication restart after replication-transcription conflicts
locus
BSU_25280
pI
8.21
mw
29.20 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
function
DNA repair/ recombination
product
mediator of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] binding to ssDNA
essential
no
synonyms
yqxN,yqfI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    2,608,946 2,609,713

    Phenotypes of a mutant

  • drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
  • ''[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] [gene|BA755FA1CB1E0C006E9A23489A7C8997141AA498|recJ]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]
  • ''[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] [gene|FC53216F600994C862F0C0D017C3FA28EB75DCB6|dprA]'' double mutants have a strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]
  • ''[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] [gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]-[gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]
  • The protein

    Catalyzed reaction/ biological activity

  • provides [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] access to ssDNA during chromosomal transformation (together with [protein|FC53216F600994C862F0C0D017C3FA28EB75DCB6|DprA]) [Pubmed|22373918]
  • catalyzes annealing of [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA] or [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA]/[protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB] coated ssDNAs to allow the formation of DNA duplexes with tails during plasmid transformation [Pubmed|22373918]
  • required for the formation of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair centers (together with [protein|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|RecR]) [Pubmed|24891441]
  • Protein family

  • recO family (single member, according to UniProt)
  • Structure

  • [PDB|2V1C] (the [protein|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|RecR]-[protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO] complex from ''Deinococcus radiodurans'', [protein|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|RecR]: 52% identity, 78% similarity, [protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO]: 30%/ 58%) [Pubmed|17581636]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • localizes to the DNA entry pole during transformation [Pubmed|22373918]
  • Expression and Regulation

    Operons

    genes
    [gene|0E9E9615CE056BEA2B65C494D946EB45F42A3064|cdd]-[gene|CB68B3393CA7862C45C624AF7B1ADD188243A01F|era]-[gene|33FBC31E8C24177137B0BDD8B46C1AFFD7F7B038|yqzL]-[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|6330116], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|6330116], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C494 (yqxN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2492 NBRP B. subtilis, Japan]
  • 1A892 ( ''recO''::''cat''), [Pubmed|10323239], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A892&Search=1A892 BGSC]
  • BKE25280 ( ''recO''::''ermC''), (available at the [http://www.bgsc.org/ BGSC] and in [SW|Fabian Commichau]'s lab) [pubmed|28189581]
  • BP738 ( ''recO''::''tet''), (available in [SW|Fabian Commichau]'s lab)
  • BP774 ( ''recO''::''ermC''), (available in [SW|Fabian Commichau]'s lab)
  • BKE25280 ([gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCACCTTCCTCAA, downstream forward: _UP4_TGACATTTGGTCCATCTTTT
  • BKK25280 ([gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCACCTTCCTCAA, downstream forward: _UP4_TGACATTTGGTCCATCTTTT
  • References

    Reviews

  • 22933559
  • Original publications

  • 24891441,18599486,19730681,20581116,22373918,17581636,21170359,24285298,24285298,25939832,26001966,15186413,10323239,26786319,23779106,30401797